\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817682484:

Variant ID: vg0817682484 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17682484
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCAATTTGTTCTTTCTAAGCGCTAATTTTGTTCTTCCATAATCAGGGAATCTCGGGACAAATTCAAACATATAGTTGCCTCATGACATTGCCATATGG[G/A]
ACAATCATAGATATGGACGTGCTGATGGTCAAAAATAATTTATTATTACATTGCTTATGCTTTTAATTTTTGCAGATTTTGCTGGGGTCATAGCTAATGT

Reverse complement sequence

ACATTAGCTATGACCCCAGCAAAATCTGCAAAAATTAAAAGCATAAGCAATGTAATAATAAATTATTTTTGACCATCAGCACGTCCATATCTATGATTGT[C/T]
CCATATGGCAATGTCATGAGGCAACTATATGTTTGAATTTGTCCCGAGATTCCCTGATTATGGAAGAACAAAATTAGCGCTTAGAAAGAACAAATTGGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.20% 10.70% 0.06% 0.00% NA
All Indica  2759 90.10% 9.90% 0.07% 0.00% NA
All Japonica  1512 85.30% 14.70% 0.00% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 66.60% 33.10% 0.34% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 93.40% 6.60% 0.00% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 65.50% 34.50% 0.00% 0.00% NA
Japonica Intermediate  241 83.00% 17.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817682484 G -> A LOC_Os08g28930.1 upstream_gene_variant ; 4691.0bp to feature; MODIFIER silent_mutation Average:41.821; most accessible tissue: Callus, score: 75.699 N N N N
vg0817682484 G -> A LOC_Os08g28900.1 downstream_gene_variant ; 3793.0bp to feature; MODIFIER silent_mutation Average:41.821; most accessible tissue: Callus, score: 75.699 N N N N
vg0817682484 G -> A LOC_Os08g28920.1 downstream_gene_variant ; 652.0bp to feature; MODIFIER silent_mutation Average:41.821; most accessible tissue: Callus, score: 75.699 N N N N
vg0817682484 G -> A LOC_Os08g28900-LOC_Os08g28920 intergenic_region ; MODIFIER silent_mutation Average:41.821; most accessible tissue: Callus, score: 75.699 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817682484 NA 1.23E-07 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817682484 NA 1.44E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817682484 NA 2.78E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817682484 NA 6.73E-07 mr1836 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817682484 NA 2.30E-12 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817682484 4.11E-06 1.99E-06 mr1040_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817682484 NA 1.96E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817682484 2.85E-06 NA mr1362_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817682484 3.12E-06 3.72E-08 mr1362_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817682484 NA 1.93E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817682484 NA 2.32E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817682484 NA 7.61E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817682484 3.97E-06 4.23E-07 mr1836_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817682484 NA 5.23E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251