\
| Variant ID: vg0817611509 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17611509 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )
AAACTTAATAATATCCCCCGTCACACATCGGAGCCAGCAATCTCCCCCACCACATCAACCTATGTGACTTGAAGACTTGTTTACTGAATTTCCCCACCAT[G/A]
TGACCCATAGAAATTCTTCTGGGTTAATTCTAAATCTAGGCTCTGATATCACTTGTTATAAAAGTTGGTAGATATAGCAGATAAATAACTAACCTTCCCA
TGGGAAGGTTAGTTATTTATCTGCTATATCTACCAACTTTTATAACAAGTGATATCAGAGCCTAGATTTAGAATTAACCCAGAAGAATTTCTATGGGTCA[C/T]
ATGGTGGGGAAATTCAGTAAACAAGTCTTCAAGTCACATAGGTTGATGTGGTGGGGGAGATTGCTGGCTCCGATGTGTGACGGGGGATATTATTAAGTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 29.00% | 71.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 68.70% | 31.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817611509 | G -> A | LOC_Os08g28784.1 | upstream_gene_variant ; 4684.0bp to feature; MODIFIER | silent_mutation | Average:59.513; most accessible tissue: Zhenshan97 young leaf, score: 69.723 | N | N | N | N |
| vg0817611509 | G -> A | LOC_Os08g28790.1 | upstream_gene_variant ; 2062.0bp to feature; MODIFIER | silent_mutation | Average:59.513; most accessible tissue: Zhenshan97 young leaf, score: 69.723 | N | N | N | N |
| vg0817611509 | G -> A | LOC_Os08g28784-LOC_Os08g28790 | intergenic_region ; MODIFIER | silent_mutation | Average:59.513; most accessible tissue: Zhenshan97 young leaf, score: 69.723 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817611509 | 1.08E-08 | 1.29E-09 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817611509 | 4.60E-11 | 7.10E-16 | mr1836 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817611509 | NA | 4.87E-07 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817611509 | 3.98E-07 | NA | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817611509 | 4.42E-08 | NA | mr1362_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817611509 | NA | 8.11E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817611509 | 1.18E-12 | NA | mr1836_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817611509 | NA | 8.43E-06 | mr1836_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |