Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817567492:

Variant ID: vg0817567492 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17567492
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

CGGCCGCGAGATTGGAAGGGAAGAGATCCCACTCGGCCTCGGTTTGGAAAGACACCACGTAATAAACAGAAACAGACTCCGCACTTCCTTTTTAGTAGTT[C/T]
TGCGTAGCCCTCCAAATAGAAACCAATCTACAAATTGTAGCACTTCATCCAAAAACCGATCTACTATCCCTTTCTCTCTTCTTCCTCACGCGCAACATCA

Reverse complement sequence

TGATGTTGCGCGTGAGGAAGAAGAGAGAAAGGGATAGTAGATCGGTTTTTGGATGAAGTGCTACAATTTGTAGATTGGTTTCTATTTGGAGGGCTACGCA[G/A]
AACTACTAAAAAGGAAGTGCGGAGTCTGTTTCTGTTTATTACGTGGTGTCTTTCCAAACCGAGGCCGAGTGGGATCTCTTCCCTTCCAATCTCGCGGCCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.20%	7.80%	0.00%	0.00%	NA
All Indica	2759	98.20%	1.80%	0.00%	0.00%	NA
All Japonica	1512	84.10%	15.90%	0.00%	0.00%	NA
Aus	269	72.90%	27.10%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	95.30%	4.70%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	62.30%	37.70%	0.00%	0.00%	NA
Japonica Intermediate	241	82.60%	17.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817567492	C -> T	LOC_Os08g28720.1	upstream_gene_variant ; 1256.0bp to feature; MODIFIER	silent_mutation	Average:47.96; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N
vg0817567492	C -> T	LOC_Os08g28730.1	downstream_gene_variant ; 2414.0bp to feature; MODIFIER	silent_mutation	Average:47.96; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N
vg0817567492	C -> T	LOC_Os08g28720-LOC_Os08g28730	intergenic_region ; MODIFIER	silent_mutation	Average:47.96; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817567492	NA	1.23E-07	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	3.70E-06	3.27E-21	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	9.55E-07	8.33E-16	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	NA	1.44E-12	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	NA	2.78E-09	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	NA	2.47E-09	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	NA	6.73E-07	mr1836	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	6.38E-07	NA	mr1980	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	NA	2.30E-12	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	4.11E-06	1.99E-06	mr1040_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	NA	5.48E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	NA	1.96E-06	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	3.12E-06	3.72E-08	mr1362_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	3.54E-06	4.25E-14	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	NA	1.93E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	NA	2.32E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	NA	7.61E-08	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	3.97E-06	4.23E-07	mr1836_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817567492	NA	5.23E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251