\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817431818:

Variant ID: vg0817431818 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17431818
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.25, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


GGTACTTAAAGATATTAAGAGATAGAACAATGTAAACCATTGATCAAGAGAGGGGCAAGGTACGGAATAAAAGTTAATGTAACCGATAGCAACGAAGTAA[A/T]
TAACTAGTAAAATATGGGTATTTTGGGTTAATCAAATACCTAGCTGAATTGATCCGTATTGTTTGGTAGAAAAAGTTGTAAATCTTACGAGGCATTTTGT

Reverse complement sequence

ACAAAATGCCTCGTAAGATTTACAACTTTTTCTACCAAACAATACGGATCAATTCAGCTAGGTATTTGATTAACCCAAAATACCCATATTTTACTAGTTA[T/A]
TTACTTCGTTGCTATCGGTTACATTAACTTTTATTCCGTACCTTGCCCCTCTCTTGATCAATGGTTTACATTGTTCTATCTCTTAATATCTTTAAGTACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 44.90% 0.25% 6.52% NA
All Indica  2759 24.70% 64.10% 0.43% 10.76% NA
All Japonica  1512 96.60% 2.80% 0.00% 0.53% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 65.20% 29.40% 0.67% 4.71% NA
Indica II  465 4.90% 93.80% 0.22% 1.08% NA
Indica III  913 14.30% 69.80% 0.33% 15.55% NA
Indica Intermediate  786 17.70% 66.30% 0.51% 15.52% NA
Temperate Japonica  767 98.30% 1.40% 0.00% 0.26% NA
Tropical Japonica  504 94.40% 4.40% 0.00% 1.19% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 56.70% 40.00% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817431818 A -> T LOC_Os08g28540.1 downstream_gene_variant ; 377.0bp to feature; MODIFIER silent_mutation Average:34.822; most accessible tissue: Callus, score: 79.492 N N N N
vg0817431818 A -> T LOC_Os08g28550.1 downstream_gene_variant ; 2474.0bp to feature; MODIFIER silent_mutation Average:34.822; most accessible tissue: Callus, score: 79.492 N N N N
vg0817431818 A -> T LOC_Os08g28540-LOC_Os08g28550 intergenic_region ; MODIFIER silent_mutation Average:34.822; most accessible tissue: Callus, score: 79.492 N N N N
vg0817431818 A -> DEL N N silent_mutation Average:34.822; most accessible tissue: Callus, score: 79.492 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817431818 NA 2.30E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818 NA 4.36E-11 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818 NA 1.13E-12 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818 NA 1.70E-13 mr1332 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818 NA 6.99E-13 mr1336 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818 NA 1.46E-07 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818 NA 1.63E-09 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818 NA 1.72E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251