| Variant ID: vg0817431818 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17431818 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.25, others allele: 0.00, population size: 195. )
GGTACTTAAAGATATTAAGAGATAGAACAATGTAAACCATTGATCAAGAGAGGGGCAAGGTACGGAATAAAAGTTAATGTAACCGATAGCAACGAAGTAA[A/T]
TAACTAGTAAAATATGGGTATTTTGGGTTAATCAAATACCTAGCTGAATTGATCCGTATTGTTTGGTAGAAAAAGTTGTAAATCTTACGAGGCATTTTGT
ACAAAATGCCTCGTAAGATTTACAACTTTTTCTACCAAACAATACGGATCAATTCAGCTAGGTATTTGATTAACCCAAAATACCCATATTTTACTAGTTA[T/A]
TTACTTCGTTGCTATCGGTTACATTAACTTTTATTCCGTACCTTGCCCCTCTCTTGATCAATGGTTTACATTGTTCTATCTCTTAATATCTTTAAGTACC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.30% | 44.90% | 0.25% | 6.52% | NA |
| All Indica | 2759 | 24.70% | 64.10% | 0.43% | 10.76% | NA |
| All Japonica | 1512 | 96.60% | 2.80% | 0.00% | 0.53% | NA |
| Aus | 269 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.20% | 29.40% | 0.67% | 4.71% | NA |
| Indica II | 465 | 4.90% | 93.80% | 0.22% | 1.08% | NA |
| Indica III | 913 | 14.30% | 69.80% | 0.33% | 15.55% | NA |
| Indica Intermediate | 786 | 17.70% | 66.30% | 0.51% | 15.52% | NA |
| Temperate Japonica | 767 | 98.30% | 1.40% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 94.40% | 4.40% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 40.00% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817431818 | A -> T | LOC_Os08g28540.1 | downstream_gene_variant ; 377.0bp to feature; MODIFIER | silent_mutation | Average:34.822; most accessible tissue: Callus, score: 79.492 | N | N | N | N |
| vg0817431818 | A -> T | LOC_Os08g28550.1 | downstream_gene_variant ; 2474.0bp to feature; MODIFIER | silent_mutation | Average:34.822; most accessible tissue: Callus, score: 79.492 | N | N | N | N |
| vg0817431818 | A -> T | LOC_Os08g28540-LOC_Os08g28550 | intergenic_region ; MODIFIER | silent_mutation | Average:34.822; most accessible tissue: Callus, score: 79.492 | N | N | N | N |
| vg0817431818 | A -> DEL | N | N | silent_mutation | Average:34.822; most accessible tissue: Callus, score: 79.492 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817431818 | NA | 2.30E-06 | mr1319 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817431818 | NA | 4.36E-11 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817431818 | NA | 1.13E-12 | mr1330 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817431818 | NA | 1.70E-13 | mr1332 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817431818 | NA | 6.99E-13 | mr1336 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817431818 | NA | 1.46E-07 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817431818 | NA | 1.63E-09 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817431818 | NA | 1.72E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |