Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0817431818:

Variant ID: vg0817431818 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17431818
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.25, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

GGTACTTAAAGATATTAAGAGATAGAACAATGTAAACCATTGATCAAGAGAGGGGCAAGGTACGGAATAAAAGTTAATGTAACCGATAGCAACGAAGTAA[A/T]
TAACTAGTAAAATATGGGTATTTTGGGTTAATCAAATACCTAGCTGAATTGATCCGTATTGTTTGGTAGAAAAAGTTGTAAATCTTACGAGGCATTTTGT

Reverse complement sequence

ACAAAATGCCTCGTAAGATTTACAACTTTTTCTACCAAACAATACGGATCAATTCAGCTAGGTATTTGATTAACCCAAAATACCCATATTTTACTAGTTA[T/A]
TTACTTCGTTGCTATCGGTTACATTAACTTTTATTCCGTACCTTGCCCCTCTCTTGATCAATGGTTTACATTGTTCTATCTCTTAATATCTTTAAGTACC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	44.90%	0.25%	6.52%	NA
All Indica	2759	24.70%	64.10%	0.43%	10.76%	NA
All Japonica	1512	96.60%	2.80%	0.00%	0.53%	NA
Aus	269	0.40%	99.60%	0.00%	0.00%	NA
Indica I	595	65.20%	29.40%	0.67%	4.71%	NA
Indica II	465	4.90%	93.80%	0.22%	1.08%	NA
Indica III	913	14.30%	69.80%	0.33%	15.55%	NA
Indica Intermediate	786	17.70%	66.30%	0.51%	15.52%	NA
Temperate Japonica	767	98.30%	1.40%	0.00%	0.26%	NA
Tropical Japonica	504	94.40%	4.40%	0.00%	1.19%	NA
Japonica Intermediate	241	95.90%	4.10%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	56.70%	40.00%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817431818	A -> T	LOC_Os08g28540.1	downstream_gene_variant ; 377.0bp to feature; MODIFIER	silent_mutation	Average:34.822; most accessible tissue: Callus, score: 79.492	N	N	N	N
vg0817431818	A -> T	LOC_Os08g28550.1	downstream_gene_variant ; 2474.0bp to feature; MODIFIER	silent_mutation	Average:34.822; most accessible tissue: Callus, score: 79.492	N	N	N	N
vg0817431818	A -> T	LOC_Os08g28540-LOC_Os08g28550	intergenic_region ; MODIFIER	silent_mutation	Average:34.822; most accessible tissue: Callus, score: 79.492	N	N	N	N
vg0817431818	A -> DEL	N	N	silent_mutation	Average:34.822; most accessible tissue: Callus, score: 79.492	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817431818	NA	2.30E-06	mr1319	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818	NA	4.36E-11	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818	NA	1.13E-12	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818	NA	1.70E-13	mr1332	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818	NA	6.99E-13	mr1336	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818	NA	1.46E-07	mr1336	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818	NA	1.63E-09	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817431818	NA	1.72E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251