\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817221859:

Variant ID: vg0817221859 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17221859
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTACTCTACATAGTTTCTTATTTCAGCTCACTCACAATATAATTATTTCTACTACAGAGAGTTACTCCCCCCTTTTCATAATGTAAGTCATTTTAGCATT[A/G]
CCCATATTCATATAGATGTTAATGAATCTAGATATAGTTGTAAATTAAAGTTACTTTTCTTTTGTTATAAGTTACTTCTATAATATATTTCTATAATATA

Reverse complement sequence

TATATTATAGAAATATATTATAGAAGTAACTTATAACAAAAGAAAAGTAACTTTAATTTACAACTATATCTAGATTCATTAACATCTATATGAATATGGG[T/C]
AATGCTAAAATGACTTACATTATGAAAAGGGGGGAGTAACTCTCTGTAGTAGAAATAATTATATTGTGAGTGAGCTGAAATAAGAAACTATGTAGAGTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.30% 15.50% 5.92% 4.23% NA
All Indica  2759 86.70% 1.60% 7.61% 4.10% NA
All Japonica  1512 47.10% 44.00% 3.51% 5.42% NA
Aus  269 93.70% 3.00% 3.35% 0.00% NA
Indica I  595 92.40% 1.70% 4.37% 1.51% NA
Indica II  465 59.10% 2.40% 24.52% 13.98% NA
Indica III  913 96.50% 0.50% 0.88% 2.08% NA
Indica Intermediate  786 87.30% 2.30% 7.89% 2.54% NA
Temperate Japonica  767 30.40% 64.70% 4.82% 0.13% NA
Tropical Japonica  504 64.90% 17.70% 2.18% 15.28% NA
Japonica Intermediate  241 63.10% 33.20% 2.07% 1.66% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 67.80% 17.80% 8.89% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817221859 A -> G LOC_Os08g28214.1 upstream_gene_variant ; 619.0bp to feature; MODIFIER silent_mutation Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0817221859 A -> G LOC_Os08g28230.1 upstream_gene_variant ; 3312.0bp to feature; MODIFIER silent_mutation Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0817221859 A -> G LOC_Os08g28214.2 upstream_gene_variant ; 619.0bp to feature; MODIFIER silent_mutation Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0817221859 A -> G LOC_Os08g28214.3 upstream_gene_variant ; 619.0bp to feature; MODIFIER silent_mutation Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0817221859 A -> G LOC_Os08g28214.6 upstream_gene_variant ; 610.0bp to feature; MODIFIER silent_mutation Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0817221859 A -> G LOC_Os08g28214.4 upstream_gene_variant ; 619.0bp to feature; MODIFIER silent_mutation Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0817221859 A -> G LOC_Os08g28214.5 upstream_gene_variant ; 619.0bp to feature; MODIFIER silent_mutation Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0817221859 A -> G LOC_Os08g28214-LOC_Os08g28230 intergenic_region ; MODIFIER silent_mutation Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0817221859 A -> DEL N N silent_mutation Average:22.236; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817221859 3.93E-06 3.80E-15 mr1401 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817221859 NA 1.45E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817221859 NA 2.87E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251