\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817018173:

Variant ID: vg0817018173 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17018173
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGAGGTTGACGCCGAAGATATGAATCGTGAGAAGTTCTGGATCTGAAGCCCCATCATCAAGTGCCACAACCCAGTCGAAGTCGGCTAAAGGTTCAACC[G/A]
GAGATAAGTCAGGTGAAGAGAAGATTCCAGCTGCAACAGGAGATCGAGCCAAGCAGTCCAGAGTGGAGAAGTTGTGCTAGGCAAGTTGTTATAAAAGACG

Reverse complement sequence

CGTCTTTTATAACAACTTGCCTAGCACAACTTCTCCACTCTGGACTGCTTGGCTCGATCTCCTGTTGCAGCTGGAATCTTCTCTTCACCTGACTTATCTC[C/T]
GGTTGAACCTTTAGCCGACTTCGACTGGGTTGTGGCACTTGATGATGGGGCTTCAGATCCAGAACTTCTCACGATTCATATCTTCGGCGTCAACCTCACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.30% 9.40% 13.65% 29.64% NA
All Indica  2759 19.90% 13.30% 19.79% 47.05% NA
All Japonica  1512 93.10% 2.20% 4.03% 0.66% NA
Aus  269 58.70% 0.40% 8.55% 32.34% NA
Indica I  595 12.80% 2.00% 9.24% 75.97% NA
Indica II  465 14.40% 23.00% 21.94% 40.65% NA
Indica III  913 21.20% 22.00% 25.41% 31.33% NA
Indica Intermediate  786 27.00% 5.90% 19.97% 47.20% NA
Temperate Japonica  767 94.30% 1.40% 3.39% 0.91% NA
Tropical Japonica  504 95.00% 1.80% 2.98% 0.20% NA
Japonica Intermediate  241 85.50% 5.40% 8.30% 0.83% NA
VI/Aromatic  96 54.20% 41.70% 4.17% 0.00% NA
Intermediate  90 74.40% 6.70% 12.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817018173 G -> A LOC_Os08g27920.1 upstream_gene_variant ; 2403.0bp to feature; MODIFIER silent_mutation Average:17.843; most accessible tissue: Minghui63 young leaf, score: 45.896 N N N N
vg0817018173 G -> A LOC_Os08g27910.1 downstream_gene_variant ; 2147.0bp to feature; MODIFIER silent_mutation Average:17.843; most accessible tissue: Minghui63 young leaf, score: 45.896 N N N N
vg0817018173 G -> A LOC_Os08g27910-LOC_Os08g27920 intergenic_region ; MODIFIER silent_mutation Average:17.843; most accessible tissue: Minghui63 young leaf, score: 45.896 N N N N
vg0817018173 G -> DEL N N silent_mutation Average:17.843; most accessible tissue: Minghui63 young leaf, score: 45.896 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817018173 NA 1.17E-06 mr1038_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817018173 8.81E-07 NA mr1039_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817018173 1.08E-07 1.08E-07 mr1389_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817018173 1.50E-06 NA mr1632_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817018173 NA 2.78E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817018173 NA 1.82E-06 mr1968_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251