\
| Variant ID: vg0817018173 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17018173 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 109. )
TGTGAGGTTGACGCCGAAGATATGAATCGTGAGAAGTTCTGGATCTGAAGCCCCATCATCAAGTGCCACAACCCAGTCGAAGTCGGCTAAAGGTTCAACC[G/A]
GAGATAAGTCAGGTGAAGAGAAGATTCCAGCTGCAACAGGAGATCGAGCCAAGCAGTCCAGAGTGGAGAAGTTGTGCTAGGCAAGTTGTTATAAAAGACG
CGTCTTTTATAACAACTTGCCTAGCACAACTTCTCCACTCTGGACTGCTTGGCTCGATCTCCTGTTGCAGCTGGAATCTTCTCTTCACCTGACTTATCTC[C/T]
GGTTGAACCTTTAGCCGACTTCGACTGGGTTGTGGCACTTGATGATGGGGCTTCAGATCCAGAACTTCTCACGATTCATATCTTCGGCGTCAACCTCACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.30% | 9.40% | 13.65% | 29.64% | NA |
| All Indica | 2759 | 19.90% | 13.30% | 19.79% | 47.05% | NA |
| All Japonica | 1512 | 93.10% | 2.20% | 4.03% | 0.66% | NA |
| Aus | 269 | 58.70% | 0.40% | 8.55% | 32.34% | NA |
| Indica I | 595 | 12.80% | 2.00% | 9.24% | 75.97% | NA |
| Indica II | 465 | 14.40% | 23.00% | 21.94% | 40.65% | NA |
| Indica III | 913 | 21.20% | 22.00% | 25.41% | 31.33% | NA |
| Indica Intermediate | 786 | 27.00% | 5.90% | 19.97% | 47.20% | NA |
| Temperate Japonica | 767 | 94.30% | 1.40% | 3.39% | 0.91% | NA |
| Tropical Japonica | 504 | 95.00% | 1.80% | 2.98% | 0.20% | NA |
| Japonica Intermediate | 241 | 85.50% | 5.40% | 8.30% | 0.83% | NA |
| VI/Aromatic | 96 | 54.20% | 41.70% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 6.70% | 12.22% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817018173 | G -> A | LOC_Os08g27920.1 | upstream_gene_variant ; 2403.0bp to feature; MODIFIER | silent_mutation | Average:17.843; most accessible tissue: Minghui63 young leaf, score: 45.896 | N | N | N | N |
| vg0817018173 | G -> A | LOC_Os08g27910.1 | downstream_gene_variant ; 2147.0bp to feature; MODIFIER | silent_mutation | Average:17.843; most accessible tissue: Minghui63 young leaf, score: 45.896 | N | N | N | N |
| vg0817018173 | G -> A | LOC_Os08g27910-LOC_Os08g27920 | intergenic_region ; MODIFIER | silent_mutation | Average:17.843; most accessible tissue: Minghui63 young leaf, score: 45.896 | N | N | N | N |
| vg0817018173 | G -> DEL | N | N | silent_mutation | Average:17.843; most accessible tissue: Minghui63 young leaf, score: 45.896 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817018173 | NA | 1.17E-06 | mr1038_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817018173 | 8.81E-07 | NA | mr1039_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817018173 | 1.08E-07 | 1.08E-07 | mr1389_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817018173 | 1.50E-06 | NA | mr1632_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817018173 | NA | 2.78E-06 | mr1795_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817018173 | NA | 1.82E-06 | mr1968_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |