\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816860308:

Variant ID: vg0816860308 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16860308
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGGACTCTTCTAGATAAGCTTCCTTTGACTGATCCGATTCCACCAGGAACACGACAGCATGGCGACTTAATGACTACCATTGGCTGTCTCTAGAACTC[G/T]
GAAGCCGACACTGACTCTCAGCCGATGATGTCTTCGGGCTTTACCAAATTTCACTGTTAACAACAGGACATCATGACTTCACGGTTTTAGCTGTAGAACA

Reverse complement sequence

TGTTCTACAGCTAAAACCGTGAAGTCATGATGTCCTGTTGTTAACAGTGAAATTTGGTAAAGCCCGAAGACATCATCGGCTGAGAGTCAGTGTCGGCTTC[C/A]
GAGTTCTAGAGACAGCCAATGGTAGTCATTAAGTCGCCATGCTGTCGTGTTCCTGGTGGAATCGGATCAGTCAAAGGAAGCTTATCTAGAAGAGTCCAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.40% 36.20% 3.13% 11.32% NA
All Indica  2759 23.20% 58.10% 4.82% 13.95% NA
All Japonica  1512 91.90% 0.90% 0.66% 6.55% NA
Aus  269 57.20% 27.50% 0.37% 14.87% NA
Indica I  595 38.30% 35.50% 9.24% 16.97% NA
Indica II  465 20.40% 67.10% 4.52% 7.96% NA
Indica III  913 13.70% 69.40% 1.97% 14.90% NA
Indica Intermediate  786 24.30% 56.60% 4.96% 14.12% NA
Temperate Japonica  767 97.50% 0.50% 0.39% 1.56% NA
Tropical Japonica  504 88.10% 1.00% 0.79% 10.12% NA
Japonica Intermediate  241 82.20% 1.70% 1.24% 14.94% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 62.20% 21.10% 4.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816860308 G -> T LOC_Os08g27660.1 upstream_gene_variant ; 2189.0bp to feature; MODIFIER silent_mutation Average:49.842; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N
vg0816860308 G -> T LOC_Os08g27672.1 downstream_gene_variant ; 3086.0bp to feature; MODIFIER silent_mutation Average:49.842; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N
vg0816860308 G -> T LOC_Os08g27674.1 downstream_gene_variant ; 3086.0bp to feature; MODIFIER silent_mutation Average:49.842; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N
vg0816860308 G -> T LOC_Os08g27650-LOC_Os08g27660 intergenic_region ; MODIFIER silent_mutation Average:49.842; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N
vg0816860308 G -> DEL N N silent_mutation Average:49.842; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816860308 NA 3.84E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 3.88E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 4.17E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 4.66E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 3.77E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 8.81E-07 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 4.23E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 7.95E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 1.42E-12 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 2.89E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 3.12E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 8.59E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 5.78E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 1.83E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 4.91E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 2.31E-08 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 3.61E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 3.51E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 1.92E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 3.55E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 2.28E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 1.52E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 1.45E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 1.24E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 4.54E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 3.71E-07 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 5.69E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 6.11E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 4.14E-06 4.14E-06 mr1983_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308 NA 1.71E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251