Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816860308:

Variant ID: vg0816860308 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16860308
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGGACTCTTCTAGATAAGCTTCCTTTGACTGATCCGATTCCACCAGGAACACGACAGCATGGCGACTTAATGACTACCATTGGCTGTCTCTAGAACTC[G/T]
GAAGCCGACACTGACTCTCAGCCGATGATGTCTTCGGGCTTTACCAAATTTCACTGTTAACAACAGGACATCATGACTTCACGGTTTTAGCTGTAGAACA

Reverse complement sequence

TGTTCTACAGCTAAAACCGTGAAGTCATGATGTCCTGTTGTTAACAGTGAAATTTGGTAAAGCCCGAAGACATCATCGGCTGAGAGTCAGTGTCGGCTTC[C/A]
GAGTTCTAGAGACAGCCAATGGTAGTCATTAAGTCGCCATGCTGTCGTGTTCCTGGTGGAATCGGATCAGTCAAAGGAAGCTTATCTAGAAGAGTCCAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.40%	36.20%	3.13%	11.32%	NA
All Indica	2759	23.20%	58.10%	4.82%	13.95%	NA
All Japonica	1512	91.90%	0.90%	0.66%	6.55%	NA
Aus	269	57.20%	27.50%	0.37%	14.87%	NA
Indica I	595	38.30%	35.50%	9.24%	16.97%	NA
Indica II	465	20.40%	67.10%	4.52%	7.96%	NA
Indica III	913	13.70%	69.40%	1.97%	14.90%	NA
Indica Intermediate	786	24.30%	56.60%	4.96%	14.12%	NA
Temperate Japonica	767	97.50%	0.50%	0.39%	1.56%	NA
Tropical Japonica	504	88.10%	1.00%	0.79%	10.12%	NA
Japonica Intermediate	241	82.20%	1.70%	1.24%	14.94%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	62.20%	21.10%	4.44%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816860308	G -> T	LOC_Os08g27660.1	upstream_gene_variant ; 2189.0bp to feature; MODIFIER	silent_mutation	Average:49.842; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg0816860308	G -> T	LOC_Os08g27672.1	downstream_gene_variant ; 3086.0bp to feature; MODIFIER	silent_mutation	Average:49.842; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg0816860308	G -> T	LOC_Os08g27674.1	downstream_gene_variant ; 3086.0bp to feature; MODIFIER	silent_mutation	Average:49.842; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg0816860308	G -> T	LOC_Os08g27650-LOC_Os08g27660	intergenic_region ; MODIFIER	silent_mutation	Average:49.842; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg0816860308	G -> DEL	N	N	silent_mutation	Average:49.842; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816860308	NA	3.84E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	3.88E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	4.17E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	4.66E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	3.77E-07	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	8.81E-07	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	4.23E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	7.95E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	1.42E-12	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	2.89E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	3.12E-06	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	8.59E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	5.78E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	1.83E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	4.91E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	2.31E-08	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	3.61E-06	mr1492_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	3.51E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	1.92E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	3.55E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	2.28E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	1.52E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	1.45E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	1.24E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	4.54E-06	mr1764_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	3.71E-07	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	5.69E-06	mr1812_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	6.11E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	4.14E-06	4.14E-06	mr1983_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860308	NA	1.71E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251