\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816679648:

Variant ID: vg0816679648 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16679648
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTAGACGAAACAATCTTTGGCCACGTGGTTGGAGTTAGGATGATGCGGGCATTGGGAGTTCATGATCTTGTCGAATGTGTTGACGCGTGAACGCTGTC[G/A]
AGAAGAGTGAGTAGCGGTTGCAACAAGTTCCTCAGGCTTACGCTTGCGGTCCTTATGATTGTTACTTCCACCCGCTCCCGTAGCCAGCGTATCCTTTTTT

Reverse complement sequence

AAAAAAGGATACGCTGGCTACGGGAGCGGGTGGAAGTAACAATCATAAGGACCGCAAGCGTAAGCCTGAGGAACTTGTTGCAACCGCTACTCACTCTTCT[C/T]
GACAGCGTTCACGCGTCAACACATTCGACAAGATCATGAACTCCCAATGCCCGCATCATCCTAACTCCAACCACGTGGCCAAAGATTGTTTCGTCTACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 5.40% 1.06% 3.98% NA
All Indica  2759 99.10% 0.40% 0.43% 0.04% NA
All Japonica  1512 69.40% 15.80% 2.38% 12.37% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 0.50% 0.84% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.10% 0.40% 0.44% 0.00% NA
Indica Intermediate  786 98.90% 0.60% 0.38% 0.13% NA
Temperate Japonica  767 79.90% 2.50% 0.52% 17.08% NA
Tropical Japonica  504 51.60% 39.90% 6.35% 2.18% NA
Japonica Intermediate  241 73.40% 7.90% 0.00% 18.67% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 96.70% 1.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816679648 G -> A LOC_Os08g27320.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:15.798; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0816679648 G -> A LOC_Os08g27310.1 upstream_gene_variant ; 1689.0bp to feature; MODIFIER silent_mutation Average:15.798; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0816679648 G -> A LOC_Os08g27300.1 downstream_gene_variant ; 4492.0bp to feature; MODIFIER silent_mutation Average:15.798; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0816679648 G -> DEL N N silent_mutation Average:15.798; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816679648 NA 5.28E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 1.80E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 8.39E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 2.78E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 2.88E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 1.10E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 2.13E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 1.79E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 3.83E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 1.02E-06 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 3.19E-06 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 2.47E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 7.22E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 1.76E-06 NA mr1771_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 7.24E-10 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648 NA 6.42E-08 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251