Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816679648:

Variant ID: vg0816679648 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16679648
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGTAGACGAAACAATCTTTGGCCACGTGGTTGGAGTTAGGATGATGCGGGCATTGGGAGTTCATGATCTTGTCGAATGTGTTGACGCGTGAACGCTGTC[G/A]
AGAAGAGTGAGTAGCGGTTGCAACAAGTTCCTCAGGCTTACGCTTGCGGTCCTTATGATTGTTACTTCCACCCGCTCCCGTAGCCAGCGTATCCTTTTTT

Reverse complement sequence

AAAAAAGGATACGCTGGCTACGGGAGCGGGTGGAAGTAACAATCATAAGGACCGCAAGCGTAAGCCTGAGGAACTTGTTGCAACCGCTACTCACTCTTCT[C/T]
GACAGCGTTCACGCGTCAACACATTCGACAAGATCATGAACTCCCAATGCCCGCATCATCCTAACTCCAACCACGTGGCCAAAGATTGTTTCGTCTACAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.60%	5.40%	1.06%	3.98%	NA
All Indica	2759	99.10%	0.40%	0.43%	0.04%	NA
All Japonica	1512	69.40%	15.80%	2.38%	12.37%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.70%	0.50%	0.84%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.10%	0.40%	0.44%	0.00%	NA
Indica Intermediate	786	98.90%	0.60%	0.38%	0.13%	NA
Temperate Japonica	767	79.90%	2.50%	0.52%	17.08%	NA
Tropical Japonica	504	51.60%	39.90%	6.35%	2.18%	NA
Japonica Intermediate	241	73.40%	7.90%	0.00%	18.67%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	96.70%	1.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816679648	G -> A	LOC_Os08g27320.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:15.798; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0816679648	G -> A	LOC_Os08g27310.1	upstream_gene_variant ; 1689.0bp to feature; MODIFIER	silent_mutation	Average:15.798; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0816679648	G -> A	LOC_Os08g27300.1	downstream_gene_variant ; 4492.0bp to feature; MODIFIER	silent_mutation	Average:15.798; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0816679648	G -> DEL	N	N	silent_mutation	Average:15.798; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816679648	NA	5.28E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	1.80E-07	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	8.39E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	2.78E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	2.88E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	1.10E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	2.13E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	1.79E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	3.83E-06	mr1550_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	1.02E-06	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	3.19E-06	mr1603_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	2.47E-08	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	7.22E-06	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	1.76E-06	NA	mr1771_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	7.24E-10	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816679648	NA	6.42E-08	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251