Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816447256:

Variant ID: vg0816447256 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16447256
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATATTTCAGTAATTACCCACATATTAAATTAATCATTAAATGGTCTAATTATAATTTTTTAAGTACTTTGAGTGTCCAAGTATTTTAAGGATTTTTCTT[G/A]
AAATTATTTGAGCATTGGAAGTATTTTTAACAATTCAAAATCATTTAAGTGATTATTTTAATTGGAAAAGTAATAAAATTCTCCTCCCTTGTCTTAGGCT

Reverse complement sequence

AGCCTAAGACAAGGGAGGAGAATTTTATTACTTTTCCAATTAAAATAATCACTTAAATGATTTTGAATTGTTAAAAATACTTCCAATGCTCAAATAATTT[C/T]
AAGAAAAATCCTTAAAATACTTGGACACTCAAAGTACTTAAAAAATTATAATTAGACCATTTAATGATTAATTTAATATGTGGGTAATTACTGAAATATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.60%	5.40%	0.02%	0.00%	NA
All Indica	2759	97.50%	2.50%	0.00%	0.00%	NA
All Japonica	1512	94.00%	5.90%	0.07%	0.00%	NA
Aus	269	71.70%	28.30%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	96.20%	3.80%	0.00%	0.00%	NA
Indica Intermediate	786	95.70%	4.30%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	84.10%	15.70%	0.20%	0.00%	NA
Japonica Intermediate	241	96.30%	3.70%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816447256	G -> A	LOC_Os08g26940.1	upstream_gene_variant ; 2927.0bp to feature; MODIFIER	silent_mutation	Average:52.949; most accessible tissue: Zhenshan97 flower, score: 81.325	N	N	N	N
vg0816447256	G -> A	LOC_Os08g26950.1	upstream_gene_variant ; 4822.0bp to feature; MODIFIER	silent_mutation	Average:52.949; most accessible tissue: Zhenshan97 flower, score: 81.325	N	N	N	N
vg0816447256	G -> A	LOC_Os08g26940-LOC_Os08g26950	intergenic_region ; MODIFIER	silent_mutation	Average:52.949; most accessible tissue: Zhenshan97 flower, score: 81.325	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816447256	1.33E-06	5.30E-10	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816447256	NA	6.61E-09	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816447256	2.78E-06	2.09E-09	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816447256	NA	1.35E-06	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816447256	NA	8.42E-06	mr1103	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816447256	NA	3.56E-08	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816447256	1.97E-08	9.72E-12	mr1227	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816447256	NA	7.52E-07	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816447256	1.08E-07	1.04E-09	mr1411	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816447256	NA	2.58E-08	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816447256	NA	6.56E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816447256	NA	1.32E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251