Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0816446429:

Variant ID: vg0816446429 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16446429
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AACCTTCTGGCTCCCTCTCAACGACTTCGCTTGTGTCTCCTGAAACATGTATGCACAACTGATAGACTGGTGCACGATGCTTCTCCTCCTCTATATATAC[G/A]
CCAACTTGCATCTTCACTTGCCATAATGAGACTATTGCATCTCAATCCAGGAGCGGTAGTTTAAATTTCAAACACACCTTGGGAATAAAACCCTGAATCT

Reverse complement sequence

AGATTCAGGGTTTTATTCCCAAGGTGTGTTTGAAATTTAAACTACCGCTCCTGGATTGAGATGCAATAGTCTCATTATGGCAAGTGAAGATGCAAGTTGG[C/T]
GTATATATAGAGGAGGAGAAGCATCGTGCACCAGTCTATCAGTTGTGCATACATGTTTCAGGAGACACAAGCGAAGTCGTTGAGAGGGAGCCAGAAGGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.30% 5.60% 0.08% 0.00% NA
All Indica  2759 97.00% 2.90% 0.14% 0.00% NA
All Japonica  1512 94.10% 5.90% 0.00% 0.00% NA
Aus  269 71.40% 28.60% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.40% 1.70% 0.86% 0.00% NA
Indica III  913 96.30% 3.70% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 4.60% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 84.30% 15.70% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816446429 G -> A LOC_Os08g26940.1 upstream_gene_variant ; 2100.0bp to feature; MODIFIER silent_mutation Average:56.056; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg0816446429 G -> A LOC_Os08g26940-LOC_Os08g26950 intergenic_region ; MODIFIER silent_mutation Average:56.056; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816446429 3.78E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 NA 2.78E-08 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 NA 2.43E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 4.87E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 NA 1.24E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 8.07E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 NA 1.58E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 NA 2.32E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 1.48E-07 6.81E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 1.09E-06 1.50E-09 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 5.00E-06 NA mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 4.88E-10 NA mr1411 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 4.18E-06 3.67E-07 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 7.28E-07 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 NA 7.47E-07 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 3.46E-06 NA mr1680 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 6.36E-06 NA mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 8.04E-06 NA mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 NA 7.20E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 5.72E-07 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 6.69E-06 6.68E-06 mr1372_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 9.13E-06 9.13E-06 mr1382_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 2.05E-08 NA mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 NA 2.69E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 NA 3.64E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816446429 NA 9.07E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251