\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816444910:

Variant ID: vg0816444910 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 16444910
Reference Allele: AAlternative Allele: G,AATTTC
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.04, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CGTATTGCCTATAACATTTGAAATTAGACCATGGAGAAGCTCTATCTAATGAAAAATTTGGTGCAAAATTTAATACCTCATAGTACCTAGGTACCAAGAG[A/G,AATTTC]
TACCAAATTTACAATAGAAAAAATGGTACCTCATGGTACCTCCTCAAGGACCGTAAAATTGCTAAAAAAAACATGTTGGTCTTCAACGGCTAGAGTACTC

Reverse complement sequence

GAGTACTCTAGCCGTTGAAGACCAACATGTTTTTTTTAGCAATTTTACGGTCCTTGAGGAGGTACCATGAGGTACCATTTTTTCTATTGTAAATTTGGTA[T/C,GAAATT]
CTCTTGGTACCTAGGTACTATGAGGTATTAAATTTTGCACCAAATTTTTCATTAGATAGAGCTTCTCCATGGTCTAATTTCAAATGTTATAGGCAATACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 30.50% 1.90% 0.00% AATTTC: 0.13%
All Indica  2759 97.90% 1.70% 0.40% 0.00% NA
All Japonica  1512 13.80% 84.00% 2.12% 0.00% AATTTC: 0.13%
Aus  269 80.70% 1.10% 16.73% 0.00% AATTTC: 1.49%
Indica I  595 97.50% 1.50% 1.01% 0.00% NA
Indica II  465 95.70% 4.10% 0.22% 0.00% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 97.60% 2.00% 0.38% 0.00% NA
Temperate Japonica  767 5.30% 94.70% 0.00% 0.00% NA
Tropical Japonica  504 27.00% 68.30% 4.56% 0.00% AATTTC: 0.20%
Japonica Intermediate  241 12.90% 83.00% 3.73% 0.00% AATTTC: 0.41%
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816444910 A -> G LOC_Os08g26940.1 upstream_gene_variant ; 581.0bp to feature; MODIFIER silent_mutation Average:56.418; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N
vg0816444910 A -> G LOC_Os08g26940-LOC_Os08g26950 intergenic_region ; MODIFIER silent_mutation Average:56.418; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N
vg0816444910 A -> AATTTC LOC_Os08g26940.1 upstream_gene_variant ; 582.0bp to feature; MODIFIER silent_mutation Average:56.418; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N
vg0816444910 A -> AATTTC LOC_Os08g26940-LOC_Os08g26950 intergenic_region ; MODIFIER silent_mutation Average:56.418; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816444910 NA 7.52E-06 mr1043_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 NA 4.79E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 NA 8.42E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 NA 9.17E-06 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 NA 2.05E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 NA 1.52E-06 mr1403_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 NA 1.31E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 NA 1.52E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 NA 5.92E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 7.58E-07 NA mr1677_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 NA 3.94E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 NA 1.72E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 NA 1.65E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 3.70E-06 NA mr1916_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816444910 NA 7.76E-10 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251