Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0816363117:

Variant ID: vg0816363117 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16363117
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAAGAGATGCAACCGATGGCTGGATGAATCACCATCAGAAGTGTAGCGCAGGATTGCAAGAGGACGTTAAACTGATCAAGAGTTTGTATATTTTGAAAG[G/A]
CACAATATATGTAGGAAAGGATAGTAAAGTATAATAACAGAATAGCAAAGCTGAATAAATGTTCCTAAGTATGTGTAGCAAATAGCAATCACTGGTTGAG

Reverse complement sequence

CTCAACCAGTGATTGCTATTTGCTACACATACTTAGGAACATTTATTCAGCTTTGCTATTCTGTTATTATACTTTACTATCCTTTCCTACATATATTGTG[C/T]
CTTTCAAAATATACAAACTCTTGATCAGTTTAACGTCCTCTTGCAATCCTGCGCTACACTTCTGATGGTGATTCATCCAGCCATCGGTTGCATCTCTTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.50%	43.00%	0.19%	0.34%	NA
All Indica	2759	84.50%	14.80%	0.22%	0.47%	NA
All Japonica	1512	7.50%	92.30%	0.07%	0.13%	NA
Aus	269	69.90%	30.10%	0.00%	0.00%	NA
Indica I	595	93.80%	6.10%	0.00%	0.17%	NA
Indica II	465	95.10%	4.50%	0.22%	0.22%	NA
Indica III	913	72.90%	26.30%	0.11%	0.66%	NA
Indica Intermediate	786	84.60%	14.20%	0.51%	0.64%	NA
Temperate Japonica	767	1.00%	98.80%	0.13%	0.00%	NA
Tropical Japonica	504	14.70%	85.10%	0.00%	0.20%	NA
Japonica Intermediate	241	12.90%	86.70%	0.00%	0.41%	NA
VI/Aromatic	96	2.10%	96.90%	1.04%	0.00%	NA
Intermediate	90	40.00%	57.80%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816363117	G -> A	LOC_Os08g26875.1	downstream_gene_variant ; 4911.0bp to feature; MODIFIER	silent_mutation	Average:51.23; most accessible tissue: Callus, score: 68.437	N	N	N	N
vg0816363117	G -> A	LOC_Os08g26875-LOC_Os08g26880	intergenic_region ; MODIFIER	silent_mutation	Average:51.23; most accessible tissue: Callus, score: 68.437	N	N	N	N
vg0816363117	G -> DEL	N	N	silent_mutation	Average:51.23; most accessible tissue: Callus, score: 68.437	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816363117	1.05E-06	3.26E-08	mr1167_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816363117	NA	3.21E-06	mr1726_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251