\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816279098:

Variant ID: vg0816279098 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16279098
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACAACCTCGGCGGGGTAGGGGTTGGCAATGTAGAACCATTTTTGCATCCAGTTCCTATCCCACTTGGCCATTGACGCGGGCACTGGCCAAGCGTCTGAG[T/C]
GCTCCGGCCGAAGCATGAAGTTCACGCAACCGAAGACGGTTTTCCTCGGACCAGCCGGCGTCTGCACGACTTTGGTCGAGGCGCATGCTGTAAATAGCGT

Reverse complement sequence

ACGCTATTTACAGCATGCGCCTCGACCAAAGTCGTGCAGACGCCGGCTGGTCCGAGGAAAACCGTCTTCGGTTGCGTGAACTTCATGCTTCGGCCGGAGC[A/G]
CTCAGACGCTTGGCCAGTGCCCGCGTCAATGGCCAAGTGGGATAGGAACTGGATGCAAAAATGGTTCTACATTGCCAACCCCTACCCCGCCGAGGTTGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.10% 1.00% 5.18% 52.75% NA
All Indica  2759 22.40% 1.50% 8.66% 67.45% NA
All Japonica  1512 74.80% 0.00% 0.20% 25.00% NA
Aus  269 17.50% 0.70% 0.74% 81.04% NA
Indica I  595 46.90% 0.80% 3.03% 49.24% NA
Indica II  465 23.90% 2.40% 10.75% 63.01% NA
Indica III  913 3.50% 1.60% 11.83% 83.02% NA
Indica Intermediate  786 24.80% 1.40% 8.02% 65.78% NA
Temperate Japonica  767 98.60% 0.00% 0.00% 1.43% NA
Tropical Japonica  504 38.10% 0.00% 0.40% 61.51% NA
Japonica Intermediate  241 75.90% 0.00% 0.41% 23.65% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 65.60% 1.10% 1.11% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816279098 T -> C LOC_Os08g26790.1 missense_variant ; p.His162Arg; MODERATE nonsynonymous_codon ; H162R Average:10.979; most accessible tissue: Callus, score: 26.615 probably damaging -2.48 TOLERATED 1.00
vg0816279098 T -> DEL LOC_Os08g26790.1 N frameshift_variant Average:10.979; most accessible tissue: Callus, score: 26.615 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816279098 NA 4.04E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 1.69E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 5.28E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 5.75E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 1.01E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 2.47E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 1.46E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 1.41E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 4.96E-06 mr1152_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 9.61E-08 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 4.61E-06 mr1239_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 5.25E-08 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 1.77E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 4.21E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 8.73E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 1.10E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 9.86E-06 NA mr1728_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 8.06E-07 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 9.23E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 8.65E-11 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 9.89E-07 3.60E-12 mr1789_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 2.17E-07 8.69E-12 mr1800_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 2.30E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816279098 NA 2.06E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251