\
| Variant ID: vg0816278155 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 16278155 |
| Reference Allele: G | Alternative Allele: A,GGCTGACTTGCACAACCTTCCCTTTCTACCCTTCGCTGTCCGAAAAGCCA |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGCTAGCAGGTGGTGGAGTCATACGCCTGCCACGAGAAGGTGCGCGCCGCAAAACCGGCGAAGTAGGAGTCCCGTCGGACCCTTCGCTGTCCGAAAAGCC[G/A,GGCTGACTTGCACAACCTTCCCTTTCTACCCTTCGCTGTCCGAAAAGCCA]
CGGCCAACTTGCACAACCTTTCCTTTCTTTTTCTTCCTCCTGGCGGTCATCACCGGTTTCGCAGCTGTGCTGGAAATCACCAGGAGGGTGTTCGCCACAA
TTGTGGCGAACACCCTCCTGGTGATTTCCAGCACAGCTGCGAAACCGGTGATGACCGCCAGGAGGAAGAAAAAGAAAGGAAAGGTTGTGCAAGTTGGCCG[C/T,TGGCTTTTCGGACAGCGAAGGGTAGAAAGGGAAGGTTGTGCAAGTCAGCC]
GGCTTTTCGGACAGCGAAGGGTCCGACGGGACTCCTACTTCGCCGGTTTTGCGGCGCGCACCTTCTCGTGGCAGGCGTATGACTCCACCACCTGCTAGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.00% | 34.70% | 9.31% | 15.40% | GGCTGACTTGCACAACCTTCCCTTTCTACCCTTCGCTGTCCGAAAAGCCA: 0.57% |
| All Indica | 2759 | 20.80% | 55.10% | 12.21% | 10.98% | GGCTGACTTGCACAACCTTCCCTTTCTACCCTTCGCTGTCCGAAAAGCCA: 0.91% |
| All Japonica | 1512 | 74.70% | 0.90% | 0.40% | 24.01% | NA |
| Aus | 269 | 16.00% | 34.90% | 33.83% | 14.50% | GGCTGACTTGCACAACCTTCCCTTTCTACCCTTCGCTGTCCGAAAAGCCA: 0.74% |
| Indica I | 595 | 44.40% | 29.60% | 9.41% | 15.80% | GGCTGACTTGCACAACCTTCCCTTTCTACCCTTCGCTGTCCGAAAAGCCA: 0.84% |
| Indica II | 465 | 21.50% | 48.80% | 15.27% | 13.55% | GGCTGACTTGCACAACCTTCCCTTTCTACCCTTCGCTGTCCGAAAAGCCA: 0.86% |
| Indica III | 913 | 3.80% | 77.70% | 11.72% | 6.02% | GGCTGACTTGCACAACCTTCCCTTTCTACCCTTCGCTGTCCGAAAAGCCA: 0.77% |
| Indica Intermediate | 786 | 22.10% | 52.00% | 13.10% | 11.58% | GGCTGACTTGCACAACCTTCCCTTTCTACCCTTCGCTGTCCGAAAAGCCA: 1.15% |
| Temperate Japonica | 767 | 98.60% | 0.00% | 0.00% | 1.43% | NA |
| Tropical Japonica | 504 | 37.90% | 2.20% | 0.40% | 59.52% | NA |
| Japonica Intermediate | 241 | 75.90% | 0.80% | 1.66% | 21.58% | NA |
| VI/Aromatic | 96 | 92.70% | 1.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 60.00% | 14.40% | 6.67% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816278155 | G -> GGCTGACTTGCACAACCTTCCCTTTCTACC CTTCGCTGTCCGAAAAGCCA | LOC_Os08g26800.1 | upstream_gene_variant ; 3506.0bp to feature; MODIFIER | silent_mutation | Average:19.151; most accessible tissue: Callus, score: 35.741 | N | N | N | N |
| vg0816278155 | G -> GGCTGACTTGCACAACCTTCCCTTTCTACC CTTCGCTGTCCGAAAAGCCA | LOC_Os08g26760.1 | downstream_gene_variant ; 3567.0bp to feature; MODIFIER | silent_mutation | Average:19.151; most accessible tissue: Callus, score: 35.741 | N | N | N | N |
| vg0816278155 | G -> GGCTGACTTGCACAACCTTCCCTTTCTACC CTTCGCTGTCCGAAAAGCCA | LOC_Os08g26770.1 | downstream_gene_variant ; 1372.0bp to feature; MODIFIER | silent_mutation | Average:19.151; most accessible tissue: Callus, score: 35.741 | N | N | N | N |
| vg0816278155 | G -> GGCTGACTTGCACAACCTTCCCTTTCTACC CTTCGCTGTCCGAAAAGCCA | LOC_Os08g26780.1 | downstream_gene_variant ; 403.0bp to feature; MODIFIER | silent_mutation | Average:19.151; most accessible tissue: Callus, score: 35.741 | N | N | N | N |
| vg0816278155 | G -> GGCTGACTTGCACAACCTTCCCTTTCTACC CTTCGCTGTCCGAAAAGCCA | LOC_Os08g26790.1 | downstream_gene_variant ; 192.0bp to feature; MODIFIER | silent_mutation | Average:19.151; most accessible tissue: Callus, score: 35.741 | N | N | N | N |
| vg0816278155 | G -> GGCTGACTTGCACAACCTTCCCTTTCTACC CTTCGCTGTCCGAAAAGCCA | LOC_Os08g26780-LOC_Os08g26790 | intergenic_region ; MODIFIER | silent_mutation | Average:19.151; most accessible tissue: Callus, score: 35.741 | N | N | N | N |
| vg0816278155 | G -> A | LOC_Os08g26800.1 | upstream_gene_variant ; 3507.0bp to feature; MODIFIER | silent_mutation | Average:19.151; most accessible tissue: Callus, score: 35.741 | N | N | N | N |
| vg0816278155 | G -> A | LOC_Os08g26760.1 | downstream_gene_variant ; 3566.0bp to feature; MODIFIER | silent_mutation | Average:19.151; most accessible tissue: Callus, score: 35.741 | N | N | N | N |
| vg0816278155 | G -> A | LOC_Os08g26770.1 | downstream_gene_variant ; 1371.0bp to feature; MODIFIER | silent_mutation | Average:19.151; most accessible tissue: Callus, score: 35.741 | N | N | N | N |
| vg0816278155 | G -> A | LOC_Os08g26780.1 | downstream_gene_variant ; 402.0bp to feature; MODIFIER | silent_mutation | Average:19.151; most accessible tissue: Callus, score: 35.741 | N | N | N | N |
| vg0816278155 | G -> A | LOC_Os08g26790.1 | downstream_gene_variant ; 193.0bp to feature; MODIFIER | silent_mutation | Average:19.151; most accessible tissue: Callus, score: 35.741 | N | N | N | N |
| vg0816278155 | G -> A | LOC_Os08g26780-LOC_Os08g26790 | intergenic_region ; MODIFIER | silent_mutation | Average:19.151; most accessible tissue: Callus, score: 35.741 | N | N | N | N |
| vg0816278155 | G -> DEL | N | N | silent_mutation | Average:19.151; most accessible tissue: Callus, score: 35.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816278155 | NA | 2.26E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 6.26E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 1.81E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 4.29E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 9.76E-24 | mr1217 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 2.03E-07 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 5.83E-23 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 6.95E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 2.28E-22 | mr1845 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 2.86E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 5.63E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 1.07E-25 | mr1077_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 1.83E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | 4.90E-06 | 1.40E-27 | mr1441_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 1.20E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 5.45E-39 | mr1771_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 3.10E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816278155 | NA | 8.18E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |