\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816277234:

Variant ID: vg0816277234 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16277234
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTAGAGGACTAGCGAACCCCATTCGTAAAGTACCTCAAGAACGGCTGGCTCCCGGAGGACGAAGCAGAAGCAAAACGCCTACAGCTTAGAGCCGCAAA[A/G]
TACAAGCTGGTCTCGGGACAGCTATATCACTCCAGGGTGCTCCAACCCTTGCTTTGCTGCATCTCCTTTGCCTAAGGTGAGGAAATGGCGAAAGAAATAC

Reverse complement sequence

GTATTTCTTTCGCCATTTCCTCACCTTAGGCAAAGGAGATGCAGCAAAGCAAGGGTTGGAGCACCCTGGAGTGATATAGCTGTCCCGAGACCAGCTTGTA[T/C]
TTTGCGGCTCTAAGCTGTAGGCGTTTTGCTTCTGCTTCGTCCTCCGGGAGCCAGCCGTTCTTGAGGTACTTTACGAATGGGGTTCGCTAGTCCTCTAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.60% 45.90% 3.15% 1.40% NA
All Indica  2759 77.20% 19.50% 2.72% 0.54% NA
All Japonica  1512 8.10% 85.90% 3.24% 2.78% NA
Aus  269 22.70% 69.10% 5.58% 2.60% NA
Indica I  595 55.50% 38.80% 4.54% 1.18% NA
Indica II  465 79.10% 17.00% 3.66% 0.22% NA
Indica III  913 92.80% 5.60% 1.42% 0.22% NA
Indica Intermediate  786 74.40% 22.60% 2.29% 0.64% NA
Temperate Japonica  767 0.50% 98.20% 1.17% 0.13% NA
Tropical Japonica  504 21.60% 66.50% 6.15% 5.75% NA
Japonica Intermediate  241 3.70% 87.60% 3.73% 4.98% NA
VI/Aromatic  96 4.20% 94.80% 0.00% 1.04% NA
Intermediate  90 28.90% 58.90% 11.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816277234 A -> G LOC_Os08g26780.1 upstream_gene_variant ; 85.0bp to feature; MODIFIER silent_mutation Average:25.037; most accessible tissue: Callus, score: 55.027 N N N N
vg0816277234 A -> G LOC_Os08g26800.1 upstream_gene_variant ; 4428.0bp to feature; MODIFIER silent_mutation Average:25.037; most accessible tissue: Callus, score: 55.027 N N N N
vg0816277234 A -> G LOC_Os08g26760.1 downstream_gene_variant ; 2645.0bp to feature; MODIFIER silent_mutation Average:25.037; most accessible tissue: Callus, score: 55.027 N N N N
vg0816277234 A -> G LOC_Os08g26770.1 downstream_gene_variant ; 450.0bp to feature; MODIFIER silent_mutation Average:25.037; most accessible tissue: Callus, score: 55.027 N N N N
vg0816277234 A -> G LOC_Os08g26790.1 downstream_gene_variant ; 1114.0bp to feature; MODIFIER silent_mutation Average:25.037; most accessible tissue: Callus, score: 55.027 N N N N
vg0816277234 A -> G LOC_Os08g26770-LOC_Os08g26780 intergenic_region ; MODIFIER silent_mutation Average:25.037; most accessible tissue: Callus, score: 55.027 N N N N
vg0816277234 A -> DEL N N silent_mutation Average:25.037; most accessible tissue: Callus, score: 55.027 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816277234 8.33E-07 3.82E-08 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277234 NA 4.64E-08 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277234 5.28E-07 8.04E-09 mr1083 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277234 4.39E-06 NA mr1139 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277234 NA 4.51E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277234 6.16E-07 1.83E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277234 NA 4.81E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277234 NA 1.03E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277234 NA 1.86E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277234 NA 1.51E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251