\
| Variant ID: vg0816277234 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16277234 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 85. )
ACCTAGAGGACTAGCGAACCCCATTCGTAAAGTACCTCAAGAACGGCTGGCTCCCGGAGGACGAAGCAGAAGCAAAACGCCTACAGCTTAGAGCCGCAAA[A/G]
TACAAGCTGGTCTCGGGACAGCTATATCACTCCAGGGTGCTCCAACCCTTGCTTTGCTGCATCTCCTTTGCCTAAGGTGAGGAAATGGCGAAAGAAATAC
GTATTTCTTTCGCCATTTCCTCACCTTAGGCAAAGGAGATGCAGCAAAGCAAGGGTTGGAGCACCCTGGAGTGATATAGCTGTCCCGAGACCAGCTTGTA[T/C]
TTTGCGGCTCTAAGCTGTAGGCGTTTTGCTTCTGCTTCGTCCTCCGGGAGCCAGCCGTTCTTGAGGTACTTTACGAATGGGGTTCGCTAGTCCTCTAGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.60% | 45.90% | 3.15% | 1.40% | NA |
| All Indica | 2759 | 77.20% | 19.50% | 2.72% | 0.54% | NA |
| All Japonica | 1512 | 8.10% | 85.90% | 3.24% | 2.78% | NA |
| Aus | 269 | 22.70% | 69.10% | 5.58% | 2.60% | NA |
| Indica I | 595 | 55.50% | 38.80% | 4.54% | 1.18% | NA |
| Indica II | 465 | 79.10% | 17.00% | 3.66% | 0.22% | NA |
| Indica III | 913 | 92.80% | 5.60% | 1.42% | 0.22% | NA |
| Indica Intermediate | 786 | 74.40% | 22.60% | 2.29% | 0.64% | NA |
| Temperate Japonica | 767 | 0.50% | 98.20% | 1.17% | 0.13% | NA |
| Tropical Japonica | 504 | 21.60% | 66.50% | 6.15% | 5.75% | NA |
| Japonica Intermediate | 241 | 3.70% | 87.60% | 3.73% | 4.98% | NA |
| VI/Aromatic | 96 | 4.20% | 94.80% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 28.90% | 58.90% | 11.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816277234 | A -> G | LOC_Os08g26780.1 | upstream_gene_variant ; 85.0bp to feature; MODIFIER | silent_mutation | Average:25.037; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| vg0816277234 | A -> G | LOC_Os08g26800.1 | upstream_gene_variant ; 4428.0bp to feature; MODIFIER | silent_mutation | Average:25.037; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| vg0816277234 | A -> G | LOC_Os08g26760.1 | downstream_gene_variant ; 2645.0bp to feature; MODIFIER | silent_mutation | Average:25.037; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| vg0816277234 | A -> G | LOC_Os08g26770.1 | downstream_gene_variant ; 450.0bp to feature; MODIFIER | silent_mutation | Average:25.037; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| vg0816277234 | A -> G | LOC_Os08g26790.1 | downstream_gene_variant ; 1114.0bp to feature; MODIFIER | silent_mutation | Average:25.037; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| vg0816277234 | A -> G | LOC_Os08g26770-LOC_Os08g26780 | intergenic_region ; MODIFIER | silent_mutation | Average:25.037; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| vg0816277234 | A -> DEL | N | N | silent_mutation | Average:25.037; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816277234 | 8.33E-07 | 3.82E-08 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816277234 | NA | 4.64E-08 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816277234 | 5.28E-07 | 8.04E-09 | mr1083 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816277234 | 4.39E-06 | NA | mr1139 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816277234 | NA | 4.51E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816277234 | 6.16E-07 | 1.83E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816277234 | NA | 4.81E-07 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816277234 | NA | 1.03E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816277234 | NA | 1.86E-07 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816277234 | NA | 1.51E-06 | mr1781_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |