Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0816276539:

Variant ID: vg0816276539 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16276539
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

CCACAAAGTCATGGTGCCATCATAGTACCCTTTGGGCGAAATACTCCGAGGCAAGGAAGTCACTGGCCGGCTCAGCAAGTGGGCAGCGGAGCTATCTCCC[T/A]
TCGACTTGCATTTTGTCGCCCGCACTACCATCAAGTCCAAAGTCCTAGCTGACTTCGTGGCCGAATGGACACCGGCATTCGCCCTCGAGCCCGAGCCTGT

Reverse complement sequence

ACAGGCTCGGGCTCGAGGGCGAATGCCGGTGTCCATTCGGCCACGAAGTCAGCTAGGACTTTGGACTTGATGGTAGTGCGGGCGACAAAATGCAAGTCGA[A/T]
GGGAGATAGCTCCGCTGCCCACTTGCTGAGCCGGCCAGTGACTTCCTTGCCTCGGAGTATTTCGCCCAAAGGGTACTATGATGGCACCATGACTTTGTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.10%	39.60%	3.68%	4.59%	NA
All Indica	2759	29.40%	65.90%	4.57%	0.11%	NA
All Japonica	1512	83.20%	1.00%	2.25%	13.56%	NA
Aus	269	86.60%	8.60%	3.35%	1.49%	NA
Indica I	595	47.10%	50.10%	2.69%	0.17%	NA
Indica II	465	28.40%	65.20%	6.45%	0.00%	NA
Indica III	913	13.70%	81.90%	4.27%	0.11%	NA
Indica Intermediate	786	35.00%	59.70%	5.22%	0.13%	NA
Temperate Japonica	767	98.70%	0.50%	0.00%	0.78%	NA
Tropical Japonica	504	60.90%	1.40%	5.16%	32.54%	NA
Japonica Intermediate	241	80.50%	1.70%	3.32%	14.52%	NA
VI/Aromatic	96	95.80%	1.00%	1.04%	2.08%	NA
Intermediate	90	74.40%	17.80%	4.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816276539	T -> A	LOC_Os08g26770.1	missense_variant ; p.Phe335Ile; MODERATE	nonsynonymous_codon ; F335I	Average:28.466; most accessible tissue: Callus, score: 47.877	possibly damaging	1.72	DELETERIOUS	0.01
vg0816276539	T -> DEL	LOC_Os08g26770.1	N	frameshift_variant	Average:28.466; most accessible tissue: Callus, score: 47.877	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816276539	NA	7.47E-06	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276539	NA	8.35E-06	mr1177_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276539	NA	9.64E-06	mr1239_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276539	NA	9.39E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276539	NA	4.60E-06	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276539	7.40E-07	4.50E-07	mr1405_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276539	9.83E-06	2.44E-06	mr1482_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276539	NA	5.70E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276539	NA	5.45E-06	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276539	NA	5.21E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276539	NA	1.89E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276539	NA	9.86E-06	mr1786_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276539	NA	1.79E-06	mr1827_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251