\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816273372:

Variant ID: vg0816273372 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16273372
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


CACAGCTTCAAGCTTTCCTTCAGCAGTCATGCCAACCCCACAACATTTCAGGTACAGCCCCTTCGGCCCAGCTAGAGGAGAACACGAGTCAAGGTGCACC[C/T]
AGTTGGTTGCCGTCGAATCAGCCTGGTCCGGGGGCTTCGCCTTGGAGTCAAGGACCGCAGTTTGACTTCGTCAACGCTGCTCAAGCACCAACCATTCGGC

Reverse complement sequence

GCCGAATGGTTGGTGCTTGAGCAGCGTTGACGAAGTCAAACTGCGGTCCTTGACTCCAAGGCGAAGCCCCCGGACCAGGCTGATTCGACGGCAACCAACT[G/A]
GGTGCACCTTGACTCGTGTTCTCCTCTAGCTGGGCCGAAGGGGCTGTACCTGAAATGTTGTGGGGTTGGCATGACTGCTGAAGGAAAGCTTGAAGCTGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 2.30% 8.99% 9.54% NA
All Indica  2759 84.80% 2.60% 8.81% 3.77% NA
All Japonica  1512 77.40% 0.80% 7.67% 14.15% NA
Aus  269 27.90% 7.10% 18.59% 46.47% NA
Indica I  595 91.80% 1.70% 4.87% 1.68% NA
Indica II  465 90.10% 1.70% 6.88% 1.29% NA
Indica III  913 79.70% 3.20% 12.05% 5.04% NA
Indica Intermediate  786 82.30% 3.20% 9.16% 5.34% NA
Temperate Japonica  767 99.10% 0.00% 0.00% 0.91% NA
Tropical Japonica  504 43.30% 2.20% 21.23% 33.33% NA
Japonica Intermediate  241 79.70% 0.40% 3.73% 16.18% NA
VI/Aromatic  96 93.80% 0.00% 4.17% 2.08% NA
Intermediate  90 75.60% 4.40% 13.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816273372 C -> T LOC_Os08g26750.1 upstream_gene_variant ; 1423.0bp to feature; MODIFIER silent_mutation Average:61.978; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg0816273372 C -> T LOC_Os08g26770.1 upstream_gene_variant ; 1586.0bp to feature; MODIFIER silent_mutation Average:61.978; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg0816273372 C -> T LOC_Os08g26780.1 upstream_gene_variant ; 3947.0bp to feature; MODIFIER silent_mutation Average:61.978; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg0816273372 C -> T LOC_Os08g26790.1 downstream_gene_variant ; 4976.0bp to feature; MODIFIER silent_mutation Average:61.978; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg0816273372 C -> T LOC_Os08g26760.1 intron_variant ; MODIFIER silent_mutation Average:61.978; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg0816273372 C -> DEL N N silent_mutation Average:61.978; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816273372 NA 2.45E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816273372 NA 8.65E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816273372 NA 1.12E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816273372 7.01E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816273372 NA 7.53E-08 mr1107 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816273372 7.41E-06 7.40E-06 mr1139 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816273372 1.24E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816273372 4.18E-07 6.37E-09 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816273372 NA 4.60E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816273372 4.47E-07 4.46E-07 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816273372 NA 5.84E-07 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816273372 NA 3.18E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816273372 NA 6.24E-06 mr1949_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251