\
| Variant ID: vg0816273372 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16273372 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 77. )
CACAGCTTCAAGCTTTCCTTCAGCAGTCATGCCAACCCCACAACATTTCAGGTACAGCCCCTTCGGCCCAGCTAGAGGAGAACACGAGTCAAGGTGCACC[C/T]
AGTTGGTTGCCGTCGAATCAGCCTGGTCCGGGGGCTTCGCCTTGGAGTCAAGGACCGCAGTTTGACTTCGTCAACGCTGCTCAAGCACCAACCATTCGGC
GCCGAATGGTTGGTGCTTGAGCAGCGTTGACGAAGTCAAACTGCGGTCCTTGACTCCAAGGCGAAGCCCCCGGACCAGGCTGATTCGACGGCAACCAACT[G/A]
GGTGCACCTTGACTCGTGTTCTCCTCTAGCTGGGCCGAAGGGGCTGTACCTGAAATGTTGTGGGGTTGGCATGACTGCTGAAGGAAAGCTTGAAGCTGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.20% | 2.30% | 8.99% | 9.54% | NA |
| All Indica | 2759 | 84.80% | 2.60% | 8.81% | 3.77% | NA |
| All Japonica | 1512 | 77.40% | 0.80% | 7.67% | 14.15% | NA |
| Aus | 269 | 27.90% | 7.10% | 18.59% | 46.47% | NA |
| Indica I | 595 | 91.80% | 1.70% | 4.87% | 1.68% | NA |
| Indica II | 465 | 90.10% | 1.70% | 6.88% | 1.29% | NA |
| Indica III | 913 | 79.70% | 3.20% | 12.05% | 5.04% | NA |
| Indica Intermediate | 786 | 82.30% | 3.20% | 9.16% | 5.34% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 43.30% | 2.20% | 21.23% | 33.33% | NA |
| Japonica Intermediate | 241 | 79.70% | 0.40% | 3.73% | 16.18% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 4.17% | 2.08% | NA |
| Intermediate | 90 | 75.60% | 4.40% | 13.33% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816273372 | C -> T | LOC_Os08g26750.1 | upstream_gene_variant ; 1423.0bp to feature; MODIFIER | silent_mutation | Average:61.978; most accessible tissue: Minghui63 flag leaf, score: 82.053 | N | N | N | N |
| vg0816273372 | C -> T | LOC_Os08g26770.1 | upstream_gene_variant ; 1586.0bp to feature; MODIFIER | silent_mutation | Average:61.978; most accessible tissue: Minghui63 flag leaf, score: 82.053 | N | N | N | N |
| vg0816273372 | C -> T | LOC_Os08g26780.1 | upstream_gene_variant ; 3947.0bp to feature; MODIFIER | silent_mutation | Average:61.978; most accessible tissue: Minghui63 flag leaf, score: 82.053 | N | N | N | N |
| vg0816273372 | C -> T | LOC_Os08g26790.1 | downstream_gene_variant ; 4976.0bp to feature; MODIFIER | silent_mutation | Average:61.978; most accessible tissue: Minghui63 flag leaf, score: 82.053 | N | N | N | N |
| vg0816273372 | C -> T | LOC_Os08g26760.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.978; most accessible tissue: Minghui63 flag leaf, score: 82.053 | N | N | N | N |
| vg0816273372 | C -> DEL | N | N | silent_mutation | Average:61.978; most accessible tissue: Minghui63 flag leaf, score: 82.053 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816273372 | NA | 2.45E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816273372 | NA | 8.65E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816273372 | NA | 1.12E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816273372 | 7.01E-06 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816273372 | NA | 7.53E-08 | mr1107 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816273372 | 7.41E-06 | 7.40E-06 | mr1139 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816273372 | 1.24E-06 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816273372 | 4.18E-07 | 6.37E-09 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816273372 | NA | 4.60E-06 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816273372 | 4.47E-07 | 4.46E-07 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816273372 | NA | 5.84E-07 | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816273372 | NA | 3.18E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816273372 | NA | 6.24E-06 | mr1949_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |