Variant ID: vg0816207802 (JBrowse) | Variation Type: INDEL |
Chromosome: chr08 | Position: 16207802 |
Reference Allele: A | Alternative Allele: ATGT |
Primary Allele: A | Secondary Allele: ATGT |
Inferred Ancestral Allele: Not determined.
ATATGCTTGATTTATATCTTGAAGAAATTCATTCTACACTAACGTTTACTCAGGGACGAGCAAAGGGCTAAGTGTGGGGGGTTTTGTTGGCGGCTGTTAA[A/ATGT]
TGCCAATTCTATACCGCCAACATCTGCATAAAGTTCAGATAATAAAACATCCAACATAGTGATAGGTGCTTAATCTCACATATTCCAAAGTGTTGGTGTA
TACACCAACACTTTGGAATATGTGAGATTAAGCACCTATCACTATGTTGGATGTTTTATTATCTGAACTTTATGCAGATGTTGGCGGTATAGAATTGGCA[T/ACAT]
TTAACAGCCGCCAACAAAACCCCCCACACTTAGCCCTTTGCTCGTCCCTGAGTAAACGTTAGTGTAGAATGAATTTCTTCAAGATATAAATCAAGCATAT
Populations | Population Size | Frequency of A(primary allele) | Frequency of ATGT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 88.80% | 0.10% | 0.87% | 10.26% | NA |
All Indica | 2759 | 88.40% | 0.10% | 1.05% | 10.37% | NA |
All Japonica | 1512 | 89.40% | 0.00% | 0.53% | 10.12% | NA |
Aus | 269 | 85.10% | 0.00% | 1.12% | 13.75% | NA |
Indica I | 595 | 86.20% | 0.00% | 1.34% | 12.44% | NA |
Indica II | 465 | 89.20% | 0.00% | 1.29% | 9.46% | NA |
Indica III | 913 | 88.40% | 0.30% | 1.31% | 9.97% | NA |
Indica Intermediate | 786 | 89.70% | 0.10% | 0.38% | 9.80% | NA |
Temperate Japonica | 767 | 99.30% | 0.00% | 0.00% | 0.65% | NA |
Tropical Japonica | 504 | 73.60% | 0.00% | 1.39% | 25.00% | NA |
Japonica Intermediate | 241 | 90.50% | 0.00% | 0.41% | 9.13% | NA |
VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
Intermediate | 90 | 91.10% | 0.00% | 0.00% | 8.89% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0816207802 | A -> ATGT | LOC_Os08g26670.1 | upstream_gene_variant ; 2081.0bp to feature; MODIFIER | silent_mutation | Average:24.891; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
vg0816207802 | A -> ATGT | LOC_Os08g26650.1 | downstream_gene_variant ; 4583.0bp to feature; MODIFIER | silent_mutation | Average:24.891; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
vg0816207802 | A -> ATGT | LOC_Os08g26660.1 | downstream_gene_variant ; 1686.0bp to feature; MODIFIER | silent_mutation | Average:24.891; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
vg0816207802 | A -> ATGT | LOC_Os08g26680.1 | downstream_gene_variant ; 4915.0bp to feature; MODIFIER | silent_mutation | Average:24.891; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
vg0816207802 | A -> ATGT | LOC_Os08g26660-LOC_Os08g26670 | intergenic_region ; MODIFIER | silent_mutation | Average:24.891; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
vg0816207802 | A -> DEL | N | N | silent_mutation | Average:24.891; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0816207802 | NA | 8.21E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0816207802 | NA | 2.69E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0816207802 | NA | 4.71E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0816207802 | NA | 4.06E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0816207802 | 1.13E-07 | 1.22E-09 | mr1082_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0816207802 | 7.87E-07 | 3.55E-08 | mr1083_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0816207802 | 5.93E-06 | NA | mr1103_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0816207802 | NA | 2.08E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |