\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816155031:

Variant ID: vg0816155031 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16155031
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATTTAATGAGGGGCACTATAGTCTTTTTTTTTAAACCTTAATATATTCTAAACAACATAGAATTACAATTATTTTGGGATGGAGGTAGTAGTACCAAT[A/C]
TTGATATTACGATCAATGTGATGGGAAAGTACAACGCACTACTAGAAAACCCGTTCGTAAAAATATAATAACGGTTTTCATGTAAAAATCGACTTTTATA

Reverse complement sequence

TATAAAAGTCGATTTTTACATGAAAACCGTTATTATATTTTTACGAACGGGTTTTCTAGTAGTGCGTTGTACTTTCCCATCACATTGATCGTAATATCAA[T/G]
ATTGGTACTACTACCTCCATCCCAAAATAATTGTAATTCTATGTTGTTTAGAATATATTAAGGTTTAAAAAAAAAGACTATAGTGCCCCTCATTAAATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 27.30% 0.51% 0.57% NA
All Indica  2759 95.00% 4.00% 0.65% 0.36% NA
All Japonica  1512 29.80% 68.80% 0.33% 1.06% NA
Aus  269 96.70% 2.60% 0.37% 0.37% NA
Indica I  595 91.80% 6.60% 1.68% 0.00% NA
Indica II  465 95.10% 4.10% 0.65% 0.22% NA
Indica III  913 97.60% 1.90% 0.11% 0.44% NA
Indica Intermediate  786 94.40% 4.50% 0.51% 0.64% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 73.20% 23.80% 0.60% 2.38% NA
Japonica Intermediate  241 27.00% 70.50% 0.83% 1.66% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816155031 A -> C LOC_Os08g26520.1 upstream_gene_variant ; 3336.0bp to feature; MODIFIER silent_mutation Average:29.279; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0816155031 A -> C LOC_Os08g26530.1 downstream_gene_variant ; 1147.0bp to feature; MODIFIER silent_mutation Average:29.279; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0816155031 A -> C LOC_Os08g26544.1 downstream_gene_variant ; 3087.0bp to feature; MODIFIER silent_mutation Average:29.279; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0816155031 A -> C LOC_Os08g26530-LOC_Os08g26544 intergenic_region ; MODIFIER silent_mutation Average:29.279; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0816155031 A -> DEL N N silent_mutation Average:29.279; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816155031 NA 1.01E-12 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0816155031 NA 5.79E-07 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 6.38E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 8.98E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 2.78E-15 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 4.55E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 7.75E-27 mr1304_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 3.92E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 1.04E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 3.96E-31 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 5.70E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 2.04E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 9.46E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 1.57E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 4.32E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 4.55E-13 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031 NA 5.83E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251