Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816155031:

Variant ID: vg0816155031 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16155031
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATTTAATGAGGGGCACTATAGTCTTTTTTTTTAAACCTTAATATATTCTAAACAACATAGAATTACAATTATTTTGGGATGGAGGTAGTAGTACCAAT[A/C]
TTGATATTACGATCAATGTGATGGGAAAGTACAACGCACTACTAGAAAACCCGTTCGTAAAAATATAATAACGGTTTTCATGTAAAAATCGACTTTTATA

Reverse complement sequence

TATAAAAGTCGATTTTTACATGAAAACCGTTATTATATTTTTACGAACGGGTTTTCTAGTAGTGCGTTGTACTTTCCCATCACATTGATCGTAATATCAA[T/G]
ATTGGTACTACTACCTCCATCCCAAAATAATTGTAATTCTATGTTGTTTAGAATATATTAAGGTTTAAAAAAAAAGACTATAGTGCCCCTCATTAAATGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	27.30%	0.51%	0.57%	NA
All Indica	2759	95.00%	4.00%	0.65%	0.36%	NA
All Japonica	1512	29.80%	68.80%	0.33%	1.06%	NA
Aus	269	96.70%	2.60%	0.37%	0.37%	NA
Indica I	595	91.80%	6.60%	1.68%	0.00%	NA
Indica II	465	95.10%	4.10%	0.65%	0.22%	NA
Indica III	913	97.60%	1.90%	0.11%	0.44%	NA
Indica Intermediate	786	94.40%	4.50%	0.51%	0.64%	NA
Temperate Japonica	767	2.10%	97.90%	0.00%	0.00%	NA
Tropical Japonica	504	73.20%	23.80%	0.60%	2.38%	NA
Japonica Intermediate	241	27.00%	70.50%	0.83%	1.66%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	53.30%	46.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816155031	A -> C	LOC_Os08g26520.1	upstream_gene_variant ; 3336.0bp to feature; MODIFIER	silent_mutation	Average:29.279; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0816155031	A -> C	LOC_Os08g26530.1	downstream_gene_variant ; 1147.0bp to feature; MODIFIER	silent_mutation	Average:29.279; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0816155031	A -> C	LOC_Os08g26544.1	downstream_gene_variant ; 3087.0bp to feature; MODIFIER	silent_mutation	Average:29.279; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0816155031	A -> C	LOC_Os08g26530-LOC_Os08g26544	intergenic_region ; MODIFIER	silent_mutation	Average:29.279; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0816155031	A -> DEL	N	N	silent_mutation	Average:29.279; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816155031	NA	1.01E-12	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0816155031	NA	5.79E-07	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	6.38E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	8.98E-09	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	2.78E-15	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	4.55E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	7.75E-27	mr1304_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	3.92E-09	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	1.04E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	3.96E-31	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	5.70E-10	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	2.04E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	9.46E-08	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	1.57E-07	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	4.32E-10	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	4.55E-13	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816155031	NA	5.83E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251