Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816117094:

Variant ID: vg0816117094 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16117094
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGATTTGGTTTGTACACCGTGTCATCATGCTAAGATGGTTGCTTCTTCACATGCTCCTATTATTTCTGTGAGGACGGATGCACCGGGACAGCTATTACA[C/T]
ATGGACACTGTTGGTCCAGCTAGAGTGCAATCTGTTGGAGGAAAGTGGTATGTGTGGGTTATTGTTCACGATTTTTCTCGATATTCTTGGGTTTTTTTTA

Reverse complement sequence

TAAAAAAAACCCAAGAATATCGAGAAAAATCGTGAACAATAACCCACACATACCACTTTCCTCCAACAGATTGCACTCTAGCTGGACCAACAGTGTCCAT[G/A]
TGTAATAGCTGTCCCGGTGCATCCGTCCTCACAGAAATAATAGGAGCATGTGAAGAAGCAACCATCTTAGCATGATGACACGGTGTACAAACCAAATCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.30%	0.70%	17.35%	56.64%	NA
All Indica	2759	6.60%	0.10%	13.66%	79.63%	NA
All Japonica	1512	56.90%	1.90%	23.61%	17.66%	NA
Aus	269	8.60%	1.10%	22.68%	67.66%	NA
Indica I	595	13.30%	0.00%	11.26%	75.46%	NA
Indica II	465	6.20%	0.00%	9.68%	84.09%	NA
Indica III	913	2.50%	0.00%	18.07%	79.41%	NA
Indica Intermediate	786	6.50%	0.40%	12.72%	80.41%	NA
Temperate Japonica	767	96.30%	0.00%	0.39%	3.26%	NA
Tropical Japonica	504	6.30%	4.60%	60.12%	28.97%	NA
Japonica Intermediate	241	36.90%	2.10%	21.16%	39.83%	NA
VI/Aromatic	96	93.80%	0.00%	6.25%	0.00%	NA
Intermediate	90	43.30%	1.10%	21.11%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816117094	C -> T	LOC_Os08g26450.1	synonymous_variant ; p.His746His; LOW	synonymous_codon	Average:7.199; most accessible tissue: Callus, score: 17.747	N	N	N	N
vg0816117094	C -> DEL	LOC_Os08g26450.1	N	frameshift_variant	Average:7.199; most accessible tissue: Callus, score: 17.747	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816117094	NA	2.64E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	7.92E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	8.14E-08	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	9.69E-09	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	1.57E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	2.28E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	5.98E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	4.95E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	8.34E-06	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	6.63E-09	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	3.47E-10	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	2.00E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	2.10E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	8.98E-10	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	1.23E-10	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	3.48E-06	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	1.16E-09	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	2.16E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	1.88E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	1.17E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	2.21E-17	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	1.10E-12	mr1742_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	3.31E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	7.37E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	1.18E-07	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	3.48E-10	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094	NA	2.02E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251