\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816117094:

Variant ID: vg0816117094 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16117094
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGATTTGGTTTGTACACCGTGTCATCATGCTAAGATGGTTGCTTCTTCACATGCTCCTATTATTTCTGTGAGGACGGATGCACCGGGACAGCTATTACA[C/T]
ATGGACACTGTTGGTCCAGCTAGAGTGCAATCTGTTGGAGGAAAGTGGTATGTGTGGGTTATTGTTCACGATTTTTCTCGATATTCTTGGGTTTTTTTTA

Reverse complement sequence

TAAAAAAAACCCAAGAATATCGAGAAAAATCGTGAACAATAACCCACACATACCACTTTCCTCCAACAGATTGCACTCTAGCTGGACCAACAGTGTCCAT[G/A]
TGTAATAGCTGTCCCGGTGCATCCGTCCTCACAGAAATAATAGGAGCATGTGAAGAAGCAACCATCTTAGCATGATGACACGGTGTACAAACCAAATCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.30% 0.70% 17.35% 56.64% NA
All Indica  2759 6.60% 0.10% 13.66% 79.63% NA
All Japonica  1512 56.90% 1.90% 23.61% 17.66% NA
Aus  269 8.60% 1.10% 22.68% 67.66% NA
Indica I  595 13.30% 0.00% 11.26% 75.46% NA
Indica II  465 6.20% 0.00% 9.68% 84.09% NA
Indica III  913 2.50% 0.00% 18.07% 79.41% NA
Indica Intermediate  786 6.50% 0.40% 12.72% 80.41% NA
Temperate Japonica  767 96.30% 0.00% 0.39% 3.26% NA
Tropical Japonica  504 6.30% 4.60% 60.12% 28.97% NA
Japonica Intermediate  241 36.90% 2.10% 21.16% 39.83% NA
VI/Aromatic  96 93.80% 0.00% 6.25% 0.00% NA
Intermediate  90 43.30% 1.10% 21.11% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816117094 C -> T LOC_Os08g26450.1 synonymous_variant ; p.His746His; LOW synonymous_codon Average:7.199; most accessible tissue: Callus, score: 17.747 N N N N
vg0816117094 C -> DEL LOC_Os08g26450.1 N frameshift_variant Average:7.199; most accessible tissue: Callus, score: 17.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816117094 NA 2.64E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 7.92E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 8.14E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 9.69E-09 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 1.57E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 2.28E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 5.98E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 4.95E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 8.34E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 6.63E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 3.47E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 2.00E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 2.10E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 8.98E-10 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 1.23E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 3.48E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 1.16E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 2.16E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 1.88E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 1.17E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 2.21E-17 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 1.10E-12 mr1742_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 3.31E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 7.37E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 1.18E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 3.48E-10 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816117094 NA 2.02E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251