\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815904383:

Variant ID: vg0815904383 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15904383
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CTTAGATCACCTCTAGGAAACAAAGTCATAGCAATCCATTTGTGCATGAGCCTAAGTGTAGGATTATGGATATCATTCGTTCTAGGTTTCTTGCAAATTG[G/T,A]
AGCACCAGACATGTCTTCCCAAAACCTATTTTTCTCGAACCCAGAAATTTCTTTCTGGAGATCGATTTTAAAGGAATCGTGAAAACCAAGAAGTGTACTT

Reverse complement sequence

AAGTACACTTCTTGGTTTTCACGATTCCTTTAAAATCGATCTCCAGAAAGAAATTTCTGGGTTCGAGAAAAATAGGTTTTGGGAAGACATGTCTGGTGCT[C/A,T]
CAATTTGCAAGAAACCTAGAACGAATGATATCCATAATCCTACACTTAGGCTCATGCACAAATGGATTGCTATGACTTTGTTTCCTAGAGGTGATCTAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 5.10% 3.30% 1.90% A: 0.02%
All Indica  2759 86.60% 8.10% 4.78% 0.47% A: 0.04%
All Japonica  1512 97.50% 0.70% 0.60% 1.19% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.90% 0.70% 4.87% 0.50% NA
Indica II  465 60.40% 27.30% 12.04% 0.22% NA
Indica III  913 98.50% 0.20% 0.55% 0.66% A: 0.11%
Indica Intermediate  786 82.70% 11.60% 5.34% 0.38% NA
Temperate Japonica  767 98.80% 1.00% 0.13% 0.00% NA
Tropical Japonica  504 97.20% 0.60% 1.19% 0.99% NA
Japonica Intermediate  241 93.80% 0.00% 0.83% 5.39% NA
VI/Aromatic  96 37.50% 0.00% 9.38% 53.12% NA
Intermediate  90 76.70% 7.80% 6.67% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815904383 G -> T LOC_Os08g26140.1 missense_variant ; p.Pro174Thr; MODERATE nonsynonymous_codon ; P174T Average:24.739; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 possibly damaging 1.718 DELETERIOUS 0.01
vg0815904383 G -> A LOC_Os08g26140.1 missense_variant ; p.Pro174Ser; MODERATE nonsynonymous_codon ; P174S Average:24.739; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 benign 0.686 DELETERIOUS 0.02
vg0815904383 G -> DEL LOC_Os08g26140.1 N frameshift_variant Average:24.739; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815904383 NA 2.65E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815904383 NA 4.72E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815904383 NA 5.81E-06 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815904383 NA 7.57E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815904383 NA 6.05E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815904383 NA 1.55E-09 mr1449_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815904383 NA 1.25E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815904383 NA 2.57E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815904383 NA 2.59E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251