Search for Variation information by Variation ID:
Detailed information for vg0815904383:
| Variant ID: vg0815904383 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15904383 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )
Flanking Sequence (100 bp) in Reference Genome:
CTTAGATCACCTCTAGGAAACAAAGTCATAGCAATCCATTTGTGCATGAGCCTAAGTGTAGGATTATGGATATCATTCGTTCTAGGTTTCTTGCAAATTG[G/T,A]
AGCACCAGACATGTCTTCCCAAAACCTATTTTTCTCGAACCCAGAAATTTCTTTCTGGAGATCGATTTTAAAGGAATCGTGAAAACCAAGAAGTGTACTT
Reverse complement sequence
AAGTACACTTCTTGGTTTTCACGATTCCTTTAAAATCGATCTCCAGAAAGAAATTTCTGGGTTCGAGAAAAATAGGTTTTGGGAAGACATGTCTGGTGCT[C/A,T]
CAATTTGCAAGAAACCTAGAACGAATGATATCCATAATCCTACACTTAGGCTCATGCACAAATGGATTGCTATGACTTTGTTTCCTAGAGGTGATCTAAG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.70% | 5.10% | 3.30% | 1.90% | A: 0.02% |
| All Indica | 2759 | 86.60% | 8.10% | 4.78% | 0.47% | A: 0.04% |
| All Japonica | 1512 | 97.50% | 0.70% | 0.60% | 1.19% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.90% | 0.70% | 4.87% | 0.50% | NA |
| Indica II | 465 | 60.40% | 27.30% | 12.04% | 0.22% | NA |
| Indica III | 913 | 98.50% | 0.20% | 0.55% | 0.66% | A: 0.11% |
| Indica Intermediate | 786 | 82.70% | 11.60% | 5.34% | 0.38% | NA |
| Temperate Japonica | 767 | 98.80% | 1.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 0.60% | 1.19% | 0.99% | NA |
| Japonica Intermediate | 241 | 93.80% | 0.00% | 0.83% | 5.39% | NA |
| VI/Aromatic | 96 | 37.50% | 0.00% | 9.38% | 53.12% | NA |
| Intermediate | 90 | 76.70% | 7.80% | 6.67% | 8.89% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815904383 | G -> T | LOC_Os08g26140.1 | missense_variant ; p.Pro174Thr; MODERATE | nonsynonymous_codon ; P174T | Average:24.739; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | possibly damaging  |
1.718 |
DELETERIOUS | 0.01 |
| vg0815904383 | G -> A | LOC_Os08g26140.1 | missense_variant ; p.Pro174Ser; MODERATE | nonsynonymous_codon ; P174S | Average:24.739; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | benign |
0.686 |
DELETERIOUS | 0.02 |
| vg0815904383 | G -> DEL | LOC_Os08g26140.1 | N | frameshift_variant | Average:24.739; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815904383 | NA | 2.65E-06 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815904383 | NA | 4.72E-06 | mr1322_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815904383 | NA | 5.81E-06 | mr1323_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815904383 | NA | 7.57E-06 | mr1338_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815904383 | NA | 6.05E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815904383 | NA | 1.55E-09 | mr1449_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815904383 | NA | 1.25E-06 | mr1449_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815904383 | NA | 2.57E-06 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815904383 | NA | 2.59E-06 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |