\
| Variant ID: vg0815712004 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15712004 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 163. )
TCCAAATTCCAAGTGATAGCCTCTCCTAGAACTCTTCCGTTGTTACAGTGATTTTTAATTTAGACTGATGCAATGAATTACTTATCTAGTTTTCATTGGA[T/C]
GGAAAAGCTAAAATCTCAATTGTGCAGTCATGATAATTAAGTTGGTATCTGTCCTACTGGTAACTCTAAACTGTCGGTTTCAGTTTCAACTAATGAACTA
TAGTTCATTAGTTGAAACTGAAACCGACAGTTTAGAGTTACCAGTAGGACAGATACCAACTTAATTATCATGACTGCACAATTGAGATTTTAGCTTTTCC[A/G]
TCCAATGAAAACTAGATAAGTAATTCATTGCATCAGTCTAAATTAAAAATCACTGTAACAACGGAAGAGTTCTAGGAGAGGCTATCACTTGGAATTTGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.20% | 38.60% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 89.20% | 10.50% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 18.90% | 81.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 40.10% | 59.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.50% | 18.20% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 86.50% | 13.10% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 27.80% | 72.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 57.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815712004 | T -> C | LOC_Os08g25820.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.723; most accessible tissue: Callus, score: 78.769 | N | N | N | N |
| vg0815712004 | T -> C | LOC_Os08g25820.2 | intron_variant ; MODIFIER | silent_mutation | Average:48.723; most accessible tissue: Callus, score: 78.769 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815712004 | NA | 1.59E-08 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815712004 | NA | 7.25E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815712004 | NA | 3.96E-06 | mr1519 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815712004 | NA | 1.63E-06 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815712004 | NA | 6.94E-06 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815712004 | 9.72E-09 | 3.04E-12 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815712004 | 1.79E-08 | 2.56E-12 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815712004 | NA | 7.26E-06 | mr1519_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815712004 | NA | 5.17E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815712004 | 2.25E-07 | 1.67E-11 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815712004 | 3.07E-06 | 1.01E-08 | mr1900_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815712004 | 2.17E-07 | 2.17E-07 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |