\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815677420:

Variant ID: vg0815677420 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15677420
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


ATCAGTATACCCAATTAAAGTCGAATCTTGGTTCTTTTTAAAGAAAAGTCCAAGATCTCTTGTGCCATTAAGATATCGAAAGACATTTTTAACTCCAGTC[T/C]
AATGGCGTTTGGTAGGAGCAGCGCTGTATCTTGCTAATAGATTTACCGAGAAAGCAATATCCGGCCTCGTACTATTTGCAAGATACATGAGTGCGCCAAT

Reverse complement sequence

ATTGGCGCACTCATGTATCTTGCAAATAGTACGAGGCCGGATATTGCTTTCTCGGTAAATCTATTAGCAAGATACAGCGCTGCTCCTACCAAACGCCATT[A/G]
GACTGGAGTTAAAAATGTCTTTCGATATCTTAATGGCACAAGAGATCTTGGACTTTTCTTTAAAAAGAACCAAGATTCGACTTTAATTGGGTATACTGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 18.80% 2.24% 1.21% NA
All Indica  2759 94.90% 0.90% 3.44% 0.80% NA
All Japonica  1512 41.70% 56.00% 0.40% 1.98% NA
Aus  269 97.40% 0.00% 1.12% 1.49% NA
Indica I  595 94.10% 0.30% 4.87% 0.67% NA
Indica II  465 92.30% 1.10% 6.02% 0.65% NA
Indica III  913 96.80% 0.50% 1.86% 0.77% NA
Indica Intermediate  786 94.80% 1.50% 2.67% 1.02% NA
Temperate Japonica  767 4.40% 91.80% 0.00% 3.78% NA
Tropical Japonica  504 87.70% 11.10% 1.19% 0.00% NA
Japonica Intermediate  241 63.90% 35.70% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 76.70% 20.00% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815677420 T -> C LOC_Os08g25734.2 upstream_gene_variant ; 4826.0bp to feature; MODIFIER silent_mutation Average:25.994; most accessible tissue: Minghui63 flag leaf, score: 38.136 N N N N
vg0815677420 T -> C LOC_Os08g25760.1 downstream_gene_variant ; 3230.0bp to feature; MODIFIER silent_mutation Average:25.994; most accessible tissue: Minghui63 flag leaf, score: 38.136 N N N N
vg0815677420 T -> C LOC_Os08g25750.1 intron_variant ; MODIFIER silent_mutation Average:25.994; most accessible tissue: Minghui63 flag leaf, score: 38.136 N N N N
vg0815677420 T -> DEL N N silent_mutation Average:25.994; most accessible tissue: Minghui63 flag leaf, score: 38.136 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815677420 NA 7.85E-22 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 9.90E-06 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 3.21E-11 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 3.74E-08 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 1.67E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 1.28E-12 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 2.41E-37 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 4.68E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 1.72E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 9.85E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 7.84E-24 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 5.70E-15 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 1.75E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 8.62E-14 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 1.70E-09 mr1844 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 3.02E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 2.30E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 3.80E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 4.11E-27 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 5.40E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 2.17E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 8.79E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815677420 NA 8.83E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251