\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815655974:

Variant ID: vg0815655974 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 15655974
Reference Allele: CGCAGTTAlternative Allele: TGCAGTT,C
Primary Allele: CGCAGTTSecondary Allele: TGCAGTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGATAACGAGATAACTATTAAATAACTATTAAAAATAATTTGTAAAACAATTTAGATATGATGTATCTAAATAACTATTAAAAATAATTGGTGCTAGCG[CGCAGTT/TGCAGTT,C]
GCGCGGATCACTCTGCTAGTTTATTTGATAATGATTTTTTTGCCGGATAAATGGGTACCCCGGTACCCATTTCATTAACAAATACACAAGACTTAGGTAT

Reverse complement sequence

ATACCTAAGTCTTGTGTATTTGTTAATGAAATGGGTACCGGGGTACCCATTTATCCGGCAAAAAAATCATTATCAAATAAACTAGCAGAGTGATCCGCGC[AACTGCG/AACTGCA,G]
CGCTAGCACCAATTATTTTTAATAGTTATTTAGATACATCATATCTAAATTGTTTTACAAATTATTTTTAATAGTTATTTAATAGTTATCTCGTTATCTT

Allele Frequencies:

Populations Population SizeFrequency of CGCAGTT(primary allele) Frequency of TGCAGTT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 10.00% 0.00% 0.00% C: 0.02%
All Indica  2759 98.10% 1.90% 0.00% 0.00% C: 0.04%
All Japonica  1512 86.40% 13.60% 0.00% 0.00% NA
Aus  269 43.50% 56.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 97.70% 2.20% 0.00% 0.00% C: 0.11%
Indica Intermediate  786 95.90% 4.10% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 66.70% 33.30% 0.00% 0.00% NA
Japonica Intermediate  241 85.10% 14.90% 0.00% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815655974 CGCAGTT -> C LOC_Os08g25720.1 upstream_gene_variant ; 2518.0bp to feature; MODIFIER silent_mutation Average:77.773; most accessible tissue: Callus, score: 92.075 N N N N
vg0815655974 CGCAGTT -> C LOC_Os08g25710-LOC_Os08g25720 intergenic_region ; MODIFIER silent_mutation Average:77.773; most accessible tissue: Callus, score: 92.075 N N N N
vg0815655974 CGCAGTT -> TGCAGTT LOC_Os08g25720.1 upstream_gene_variant ; 2519.0bp to feature; MODIFIER silent_mutation Average:77.773; most accessible tissue: Callus, score: 92.075 N N N N
vg0815655974 CGCAGTT -> TGCAGTT LOC_Os08g25710-LOC_Os08g25720 intergenic_region ; MODIFIER silent_mutation Average:77.773; most accessible tissue: Callus, score: 92.075 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815655974 NA 8.81E-08 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815655974 NA 3.24E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815655974 NA 5.97E-08 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815655974 NA 1.08E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815655974 NA 8.49E-08 mr1734 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815655974 NA 1.42E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815655974 NA 8.00E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815655974 NA 8.78E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815655974 NA 6.54E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815655974 NA 6.10E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815655974 NA 4.06E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815655974 NA 4.81E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815655974 NA 1.61E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251