Variant ID: vg0815631643 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 15631643 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGAACATGTACTTTCTCTGTCCCAAAAAAAACTTAACCTAGAAGGGAATATGACCCCTTCTAAGACAACGAATCTGGACTACCTTTTGTCTGGGTTTATT[A/G]
TTCGAGGAGGGGTCACATTCCGTTCTAGATTGAATTTTTTGGAACAAAGGTACTACATGTTCTCCTACCGTCGGTCCTACCAGGATGCGACTCTTTCCAT
ATGGAAAGAGTCGCATCCTGGTAGGACCGACGGTAGGAGAACATGTAGTACCTTTGTTCCAAAAAATTCAATCTAGAACGGAATGTGACCCCTCCTCGAA[T/C]
AATAAACCCAGACAAAAGGTAGTCCAGATTCGTTGTCTTAGAAGGGGTCATATTCCCTTCTAGGTTAAGTTTTTTTTGGGACAGAGAAAGTACATGTTCT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 74.80% | 24.80% | 0.06% | 0.28% | NA |
All Indica | 2759 | 91.40% | 8.10% | 0.11% | 0.40% | NA |
All Japonica | 1512 | 38.60% | 61.40% | 0.00% | 0.00% | NA |
Aus | 269 | 99.30% | 0.40% | 0.00% | 0.37% | NA |
Indica I | 595 | 99.70% | 0.20% | 0.00% | 0.17% | NA |
Indica II | 465 | 95.50% | 4.30% | 0.22% | 0.00% | NA |
Indica III | 913 | 84.20% | 15.00% | 0.11% | 0.66% | NA |
Indica Intermediate | 786 | 91.10% | 8.30% | 0.13% | 0.51% | NA |
Temperate Japonica | 767 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 72.60% | 27.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 30.70% | 69.30% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 75.60% | 23.30% | 0.00% | 1.11% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0815631643 | A -> G | LOC_Os08g25690.1 | upstream_gene_variant ; 691.0bp to feature; MODIFIER | silent_mutation | Average:59.016; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
vg0815631643 | A -> G | LOC_Os08g25690-LOC_Os08g25700 | intergenic_region ; MODIFIER | silent_mutation | Average:59.016; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
vg0815631643 | A -> DEL | N | N | silent_mutation | Average:59.016; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0815631643 | 2.23E-08 | 2.22E-11 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815631643 | NA | 7.82E-07 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815631643 | NA | 1.74E-10 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815631643 | NA | 7.69E-06 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815631643 | 3.01E-06 | 8.17E-09 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815631643 | 3.06E-10 | 1.74E-13 | mr1238_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815631643 | 1.31E-09 | 3.43E-13 | mr1484_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815631643 | NA | 9.05E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815631643 | 1.46E-10 | 5.87E-14 | mr1841_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815631643 | NA | 5.63E-08 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815631643 | 2.39E-08 | 2.39E-08 | mr1945_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |