\
| Variant ID: vg0815549377 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15549377 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 263. )
ACTCAGGGGCCCGAACCTGTATAAAAATCCTCGTCCCCGTCTCTTTTACCTCAGTCTCGCGTATATCCTAGCACCGACGATCCCCATACTATACAAATAC[C/T]
GGAATCGCAACATCAAACGTCGACACAGCCGATGTATGATTTAACCATCGGATCACATATTCTATGATATTATTGTCAGCCGATTGATTTACATTGGATT
AATCCAATGTAAATCAATCGGCTGACAATAATATCATAGAATATGTGATCCGATGGTTAAATCATACATCGGCTGTGTCGACGTTTGATGTTGCGATTCC[G/A]
GTATTTGTATAGTATGGGGATCGTCGGTGCTAGGATATACGCGAGACTGAGGTAAAAGAGACGGGGACGAGGATTTTTATACAGGTTCGGGCCCCTGAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815549377 | C -> T | LOC_Os08g25570.1 | upstream_gene_variant ; 4762.0bp to feature; MODIFIER | silent_mutation | Average:41.996; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg0815549377 | C -> T | LOC_Os08g25560-LOC_Os08g25570 | intergenic_region ; MODIFIER | silent_mutation | Average:41.996; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815549377 | 3.65E-06 | NA | mr1040_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815549377 | NA | 1.96E-06 | mr1040_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815549377 | NA | 8.73E-06 | mr1362_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815549377 | NA | 2.89E-06 | mr1405_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815549377 | 8.33E-07 | NA | mr1733_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815549377 | 1.04E-06 | NA | mr1771_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |