\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815549377:

Variant ID: vg0815549377 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15549377
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ACTCAGGGGCCCGAACCTGTATAAAAATCCTCGTCCCCGTCTCTTTTACCTCAGTCTCGCGTATATCCTAGCACCGACGATCCCCATACTATACAAATAC[C/T]
GGAATCGCAACATCAAACGTCGACACAGCCGATGTATGATTTAACCATCGGATCACATATTCTATGATATTATTGTCAGCCGATTGATTTACATTGGATT

Reverse complement sequence

AATCCAATGTAAATCAATCGGCTGACAATAATATCATAGAATATGTGATCCGATGGTTAAATCATACATCGGCTGTGTCGACGTTTGATGTTGCGATTCC[G/A]
GTATTTGTATAGTATGGGGATCGTCGGTGCTAGGATATACGCGAGACTGAGGTAAAAGAGACGGGGACGAGGATTTTTATACAGGTTCGGGCCCCTGAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 4.60% 0.00% 0.00% NA
All Indica  2759 99.10% 0.90% 0.00% 0.00% NA
All Japonica  1512 92.00% 8.00% 0.00% 0.00% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.70% 0.00% 0.00% NA
Temperate Japonica  767 91.90% 8.10% 0.00% 0.00% NA
Tropical Japonica  504 89.50% 10.50% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815549377 C -> T LOC_Os08g25570.1 upstream_gene_variant ; 4762.0bp to feature; MODIFIER silent_mutation Average:41.996; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0815549377 C -> T LOC_Os08g25560-LOC_Os08g25570 intergenic_region ; MODIFIER silent_mutation Average:41.996; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815549377 3.65E-06 NA mr1040_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815549377 NA 1.96E-06 mr1040_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815549377 NA 8.73E-06 mr1362_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815549377 NA 2.89E-06 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815549377 8.33E-07 NA mr1733_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815549377 1.04E-06 NA mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251