\
| Variant ID: vg0815172680 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15172680 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTGAAAAAGTTATCAACAACAAAGTTGAATAAAACATCAAGATCTAAAACTTTTATTTTGATCATTTCTTCATCTGATAAAATGTTAGTAACATTGTTCA[C/T]
AAATTTTATATATATGTGTTATAGTTTATAAAACCAGATAAGAGATATGTCAATTTTGTGAACAATGTTACTATTACTTTATCAGATGAAGAAATGACCA
TGGTCATTTCTTCATCTGATAAAGTAATAGTAACATTGTTCACAAAATTGACATATCTCTTATCTGGTTTTATAAACTATAACACATATATATAAAATTT[G/A]
TGAACAATGTTACTAACATTTTATCAGATGAAGAAATGATCAAAATAAAAGTTTTAGATCTTGATGTTTTATTCAACTTTGTTGTTGATAACTTTTTCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.40% | 1.40% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 98.10% | 1.60% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.00% | 2.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 1.70% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 2.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815172680 | C -> T | LOC_Os08g25010-LOC_Os08g25020 | intergenic_region ; MODIFIER | N | Average:17.351; most accessible tissue: Callus, score: 27.339 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815172680 | 2.47E-06 | 2.68E-07 | mr1334 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815172680 | 4.76E-06 | NA | mr1750 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815172680 | 2.41E-06 | NA | mr1935 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815172680 | 7.31E-06 | NA | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815172680 | 6.15E-07 | NA | mr1987 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815172680 | 5.96E-06 | 5.96E-06 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |