Search for Variation information by Variation ID:
Detailed information for vg0814644598:
| Variant ID: vg0814644598 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 14644598 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 204. )
Flanking Sequence (100 bp) in Reference Genome:
GAGATTCCTGAAGCTGAAGCGCAGACAACTTCTCAAGGACCAGAAGTTGGTAATGACTCGATGATTGGGTCTCCGGATAAAGGGCAAAAAACACCTCACG[C/T]
TCAGCTAGGCACATCCTCAGGTAACTCATCTTCTCAAGTAATGCCGTTTTGAACAACTCCAGCTTGTTCGTCTAATGTCTTGGGAATACATCAGGTTCAC
Reverse complement sequence
GTGAACCTGATGTATTCCCAAGACATTAGACGAACAAGCTGGAGTTGTTCAAAACGGCATTACTTGAGAAGATGAGTTACCTGAGGATGTGCCTAGCTGA[G/A]
CGTGAGGTGTTTTTTGCCCTTTATCCGGAGACCCAATCATCGAGTCATTACCAACTTCTGGTCCTTGAGAAGTTGTCTGCGCTTCAGCTTCAGGAATCTC
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 3.30% | 1.38% | 3.98% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.04% | NA |
| All Japonica | 1512 | 73.70% | 10.10% | 4.10% | 12.10% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.00% | 1.12% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 79.40% | 3.10% | 4.43% | 13.04% | NA |
| Tropical Japonica | 504 | 64.90% | 22.40% | 4.56% | 8.13% | NA |
| Japonica Intermediate | 241 | 73.90% | 6.60% | 2.07% | 17.43% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 4.40% | 2.22% | 1.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0814644598 | C -> T | LOC_Os08g24260.1 | missense_variant ; p.Ala542Val; MODERATE | nonsynonymous_codon ; A542V | Average:18.214; most accessible tissue: Zhenshan97 young leaf, score: 37.172 | benign  |
1.453 |
TOLERATED | 0.10 |
| vg0814644598 | C -> DEL | LOC_Os08g24260.1 | N | frameshift_variant | Average:18.214; most accessible tissue: Zhenshan97 young leaf, score: 37.172 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0814644598 | NA | 4.15E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814644598 | 8.55E-06 | 1.18E-06 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814644598 | NA | 4.27E-06 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814644598 | 9.87E-06 | 1.93E-06 | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814644598 | 5.63E-06 | 5.63E-06 | mr1484_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814644598 | 1.34E-06 | 1.34E-06 | mr1945_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |