\
| Variant ID: vg0813872533 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13872533 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )
GCACCGAGCCAGGCAGATGCGAGACGTATCTGCCAGATTCCAGGAGCCGCTCAGAGGGACCTGGTGACGAGCAGGAGGACGCCTTCGACTCCACCGACCG[C/T]
AGGAGCCGTTCCGAGCATTAGGCTCGCTTTCCATTAGTTTATCGACTATTTAGCATTTGCCTGTTAGTTTGTGTGTTTAGGTCTGCTCGCTTGTGGGTCA
TGACCCACAAGCGAGCAGACCTAAACACACAAACTAACAGGCAAATGCTAAATAGTCGATAAACTAATGGAAAGCGAGCCTAATGCTCGGAACGGCTCCT[G/A]
CGGTCGGTGGAGTCGAAGGCGTCCTCCTGCTCGTCACCAGGTCCCTCTGAGCGGCTCCTGGAATCTGGCAGATACGTCTCGCATCTGCCTGGCTCGGTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.60% | 4.50% | 0.17% | 0.63% | NA |
| All Indica | 2759 | 91.00% | 7.60% | 0.29% | 1.09% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.20% | 0.00% | 0.17% | NA |
| Indica II | 465 | 95.30% | 4.10% | 0.22% | 0.43% | NA |
| Indica III | 913 | 83.80% | 13.10% | 0.77% | 2.30% | NA |
| Indica Intermediate | 786 | 91.70% | 7.50% | 0.00% | 0.76% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813872533 | C -> T | LOC_Os08g23040.1 | synonymous_variant ; p.Arg249Arg; LOW | synonymous_codon | Average:67.517; most accessible tissue: Zhenshan97 flag leaf, score: 82.17 | N | N | N | N |
| vg0813872533 | C -> DEL | LOC_Os08g23040.1 | N | frameshift_variant | Average:67.517; most accessible tissue: Zhenshan97 flag leaf, score: 82.17 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813872533 | 1.00E-07 | 1.85E-10 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813872533 | 7.29E-08 | 2.91E-09 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813872533 | 8.02E-06 | 8.74E-07 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813872533 | 3.57E-09 | 2.61E-11 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813872533 | 3.05E-08 | 3.05E-08 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813872533 | 4.16E-07 | 3.25E-10 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813872533 | 3.92E-07 | 1.41E-09 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813872533 | 2.17E-06 | 3.83E-11 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813872533 | 1.95E-06 | 1.16E-09 | mr1900_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813872533 | 2.91E-06 | 2.91E-06 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |