\
| Variant ID: vg0813660047 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13660047 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.34, others allele: 0.00, population size: 50. )
CATAGCTCGAGGATTGTATTTACAAAATAGCTTTGAGCAACTAAATGTCCTTAATGCTGTTTACTGCAAACCCTAACCCCTTATATTAAAACCCCCATTG[T/C]
ACTCCCTTGCATTTATTCTACACTTGTGGGTGTGTCTTGTTGAGTACGGTGGTTGTACTCAGTCTTGCTCAATTTTTCCCAAACCCAGAAGTGGAGTTCC
GGAACTCCACTTCTGGGTTTGGGAAAAATTGAGCAAGACTGAGTACAACCACCGTACTCAACAAGACACACCCACAAGTGTAGAATAAATGCAAGGGAGT[A/G]
CAATGGGGGTTTTAATATAAGGGGTTAGGGTTTGCAGTAAACAGCATTAAGGACATTTAGTTGCTCAAAGCTATTTTGTAAATACAATCCTCGAGCTATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.60% | 3.60% | 3.91% | 55.86% | NA |
| All Indica | 2759 | 16.00% | 5.80% | 5.22% | 72.96% | NA |
| All Japonica | 1512 | 66.70% | 0.30% | 1.79% | 31.28% | NA |
| Aus | 269 | 84.00% | 1.90% | 0.74% | 13.38% | NA |
| Indica I | 595 | 6.60% | 3.20% | 5.04% | 85.21% | NA |
| Indica II | 465 | 12.50% | 5.20% | 5.16% | 77.20% | NA |
| Indica III | 913 | 21.50% | 8.80% | 5.37% | 64.40% | NA |
| Indica Intermediate | 786 | 19.00% | 4.70% | 5.22% | 71.12% | NA |
| Temperate Japonica | 767 | 93.20% | 0.10% | 0.26% | 6.39% | NA |
| Tropical Japonica | 504 | 38.50% | 0.20% | 2.98% | 58.33% | NA |
| Japonica Intermediate | 241 | 41.10% | 0.80% | 4.15% | 53.94% | NA |
| VI/Aromatic | 96 | 19.80% | 0.00% | 6.25% | 73.96% | NA |
| Intermediate | 90 | 41.10% | 0.00% | 6.67% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813660047 | T -> C | LOC_Os08g22710.1 | downstream_gene_variant ; 3220.0bp to feature; MODIFIER | silent_mutation | Average:23.558; most accessible tissue: Zhenshan97 root, score: 34.536 | N | N | N | N |
| vg0813660047 | T -> C | LOC_Os08g22710-LOC_Os08g22740 | intergenic_region ; MODIFIER | silent_mutation | Average:23.558; most accessible tissue: Zhenshan97 root, score: 34.536 | N | N | N | N |
| vg0813660047 | T -> DEL | N | N | silent_mutation | Average:23.558; most accessible tissue: Zhenshan97 root, score: 34.536 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813660047 | NA | 3.35E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | NA | 9.12E-06 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | NA | 1.95E-07 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | NA | 2.85E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | NA | 3.25E-08 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | NA | 2.97E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | NA | 2.67E-06 | mr1504 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | NA | 7.21E-07 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | NA | 3.27E-06 | mr1672 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | 4.01E-06 | NA | mr1743 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | NA | 9.69E-06 | mr1821 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | NA | 1.05E-06 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | NA | 1.51E-14 | mr1883 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | 1.31E-06 | 1.30E-06 | mr1883 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | 2.16E-06 | 2.16E-06 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | NA | 9.91E-12 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813660047 | NA | 2.88E-08 | mr1672_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |