\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813623119:

Variant ID: vg0813623119 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13623119
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TTCACCCAAGTGTATGGGATGTCACGGTAGCCGTGAGGGAGGGAGTCCGACTCAGAAATCTCGGCTTGATGGTAGTGGGCGGCAAAGGAAGGACACGGCA[C/T]
ACGGAATCCGAATAAAAGGAAAACTCTCATGCAAGGAAACCGAATCCGGTTGAAATAGAAACCGATCCAATCTACTACCAAAAAACGATCTAATCTAATC

Reverse complement sequence

GATTAGATTAGATCGTTTTTTGGTAGTAGATTGGATCGGTTTCTATTTCAACCGGATTCGGTTTCCTTGCATGAGAGTTTTCCTTTTATTCGGATTCCGT[G/A]
TGCCGTGTCCTTCCTTTGCCGCCCACTACCATCAAGCCGAGATTTCTGAGTCGGACTCCCTCCCTCACGGCTACCGTGACATCCCATACACTTGGGTGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.00% 48.70% 0.25% 0.04% NA
All Indica  2759 83.50% 16.20% 0.25% 0.04% NA
All Japonica  1512 1.80% 97.80% 0.33% 0.07% NA
Aus  269 16.70% 83.30% 0.00% 0.00% NA
Indica I  595 97.00% 2.50% 0.34% 0.17% NA
Indica II  465 87.10% 12.90% 0.00% 0.00% NA
Indica III  913 76.60% 23.20% 0.22% 0.00% NA
Indica Intermediate  786 79.10% 20.50% 0.38% 0.00% NA
Temperate Japonica  767 2.00% 97.90% 0.13% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 95.40% 1.66% 0.41% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 34.40% 65.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813623119 C -> T LOC_Os08g22640.1 upstream_gene_variant ; 726.0bp to feature; MODIFIER silent_mutation Average:42.776; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0813623119 C -> T LOC_Os08g22650.1 upstream_gene_variant ; 1212.0bp to feature; MODIFIER silent_mutation Average:42.776; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0813623119 C -> T LOC_Os08g22640-LOC_Os08g22650 intergenic_region ; MODIFIER silent_mutation Average:42.776; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0813623119 C -> DEL N N silent_mutation Average:42.776; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813623119 NA 5.79E-17 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 4.16E-07 mr1134_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 6.85E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 1.78E-19 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 3.50E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 5.59E-34 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 1.74E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 1.27E-25 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 3.02E-06 1.95E-06 mr1504_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 1.09E-06 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 5.93E-06 mr1672_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 3.73E-12 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 2.73E-08 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 8.73E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 8.66E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 1.14E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 1.83E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 1.74E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 3.83E-28 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813623119 NA 4.45E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251