| Variant ID: vg0813601775 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13601775 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CGTCGAGTGCGGTACACAAGTGATTCAAGCTCATTACATGCCCTTTCTTAGCCCCACCCCAACCACCTATACCACGCTGGGGTTCCCGACGACTCAGTCA[T/C,A]
GTGCGTGCGTGATGTGACCAAGGCGGGCGCGCCACGCGGGAGGCACCCCCGGCCAAACCTAGGCACCGGAGGCCCTCCAAAGGCTACCTGCCTCACGACT
AGTCGTGAGGCAGGTAGCCTTTGGAGGGCCTCCGGTGCCTAGGTTTGGCCGGGGGTGCCTCCCGCGTGGCGCGCCCGCCTTGGTCACATCACGCACGCAC[A/G,T]
TGACTGAGTCGTCGGGAACCCCAGCGTGGTATAGGTGGTTGGGGTGGGGCTAAGAAAGGGCATGTAATGAGCTTGAATCACTTGTGTACCGCACTCGACG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.20% | 0.10% | 1.99% | 1.65% | A: 0.02% |
| All Indica | 2759 | 96.20% | 0.10% | 1.56% | 2.03% | A: 0.04% |
| All Japonica | 1512 | 96.20% | 0.10% | 3.17% | 0.53% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 99.20% | 0.00% | 0.17% | 0.67% | NA |
| Indica II | 465 | 96.60% | 0.20% | 1.72% | 1.51% | NA |
| Indica III | 913 | 93.30% | 0.10% | 2.96% | 3.50% | A: 0.11% |
| Indica Intermediate | 786 | 97.20% | 0.30% | 0.89% | 1.65% | NA |
| Temperate Japonica | 767 | 94.30% | 0.10% | 5.61% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.00% | 1.66% | 2.49% | NA |
| VI/Aromatic | 96 | 87.50% | 0.00% | 1.04% | 11.46% | NA |
| Intermediate | 90 | 94.40% | 1.10% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813601775 | T -> C | LOC_Os08g22610.1 | upstream_gene_variant ; 4823.0bp to feature; MODIFIER | silent_mutation | Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0813601775 | T -> C | LOC_Os08g22604.1 | downstream_gene_variant ; 1393.0bp to feature; MODIFIER | silent_mutation | Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0813601775 | T -> C | LOC_Os08g22600-LOC_Os08g22604 | intergenic_region ; MODIFIER | silent_mutation | Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0813601775 | T -> A | LOC_Os08g22610.1 | upstream_gene_variant ; 4823.0bp to feature; MODIFIER | silent_mutation | Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0813601775 | T -> A | LOC_Os08g22604.1 | downstream_gene_variant ; 1393.0bp to feature; MODIFIER | silent_mutation | Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0813601775 | T -> A | LOC_Os08g22600-LOC_Os08g22604 | intergenic_region ; MODIFIER | silent_mutation | Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0813601775 | T -> DEL | N | N | silent_mutation | Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813601775 | 1.77E-06 | 5.78E-08 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813601775 | 1.51E-06 | NA | mr1275 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813601775 | 1.70E-06 | 1.70E-06 | mr1275 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813601775 | NA | 5.90E-07 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813601775 | 4.40E-06 | 4.40E-06 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813601775 | 6.50E-08 | NA | mr1943 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813601775 | 4.02E-07 | 1.16E-07 | mr1943 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813601775 | 2.20E-06 | 2.20E-06 | mr1945 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |