Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0813601775:

Variant ID: vg0813601775 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 13601775
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTCGAGTGCGGTACACAAGTGATTCAAGCTCATTACATGCCCTTTCTTAGCCCCACCCCAACCACCTATACCACGCTGGGGTTCCCGACGACTCAGTCA[T/C,A]
GTGCGTGCGTGATGTGACCAAGGCGGGCGCGCCACGCGGGAGGCACCCCCGGCCAAACCTAGGCACCGGAGGCCCTCCAAAGGCTACCTGCCTCACGACT

Reverse complement sequence

AGTCGTGAGGCAGGTAGCCTTTGGAGGGCCTCCGGTGCCTAGGTTTGGCCGGGGGTGCCTCCCGCGTGGCGCGCCCGCCTTGGTCACATCACGCACGCAC[A/G,T]
TGACTGAGTCGTCGGGAACCCCAGCGTGGTATAGGTGGTTGGGGTGGGGCTAAGAAAGGGCATGTAATGAGCTTGAATCACTTGTGTACCGCACTCGACG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.20%	0.10%	1.99%	1.65%	A: 0.02%
All Indica	2759	96.20%	0.10%	1.56%	2.03%	A: 0.04%
All Japonica	1512	96.20%	0.10%	3.17%	0.53%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	99.20%	0.00%	0.17%	0.67%	NA
Indica II	465	96.60%	0.20%	1.72%	1.51%	NA
Indica III	913	93.30%	0.10%	2.96%	3.50%	A: 0.11%
Indica Intermediate	786	97.20%	0.30%	0.89%	1.65%	NA
Temperate Japonica	767	94.30%	0.10%	5.61%	0.00%	NA
Tropical Japonica	504	99.40%	0.00%	0.20%	0.40%	NA
Japonica Intermediate	241	95.90%	0.00%	1.66%	2.49%	NA
VI/Aromatic	96	87.50%	0.00%	1.04%	11.46%	NA
Intermediate	90	94.40%	1.10%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0813601775	T -> C	LOC_Os08g22610.1	upstream_gene_variant ; 4823.0bp to feature; MODIFIER	silent_mutation	Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N
vg0813601775	T -> C	LOC_Os08g22604.1	downstream_gene_variant ; 1393.0bp to feature; MODIFIER	silent_mutation	Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N
vg0813601775	T -> C	LOC_Os08g22600-LOC_Os08g22604	intergenic_region ; MODIFIER	silent_mutation	Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N
vg0813601775	T -> A	LOC_Os08g22610.1	upstream_gene_variant ; 4823.0bp to feature; MODIFIER	silent_mutation	Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N
vg0813601775	T -> A	LOC_Os08g22604.1	downstream_gene_variant ; 1393.0bp to feature; MODIFIER	silent_mutation	Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N
vg0813601775	T -> A	LOC_Os08g22600-LOC_Os08g22604	intergenic_region ; MODIFIER	silent_mutation	Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N
vg0813601775	T -> DEL	N	N	silent_mutation	Average:59.518; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0813601775	1.77E-06	5.78E-08	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813601775	1.51E-06	NA	mr1275	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813601775	1.70E-06	1.70E-06	mr1275	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813601775	NA	5.90E-07	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813601775	4.40E-06	4.40E-06	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813601775	6.50E-08	NA	mr1943	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813601775	4.02E-07	1.16E-07	mr1943	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813601775	2.20E-06	2.20E-06	mr1945	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251