\
| Variant ID: vg0813433527 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13433527 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 213. )
GATAATTTGGGAACATTCCTCCTGGTAGATAAACTGGTCCTGTAGCTTGATACTCGGCCATTGAACCATCAACCATTGTTTTCACGATGTTTGACAAAGT[A/G]
TTGACTAATATTCCAGACTGATTGATCAAAGCATGGTGCACGGCATAGTCAACCTGATGTTGGAAGTTGTTAAACTGTAACTGTGCCGTATTGCCATCTT
AAGATGGCAATACGGCACAGTTACAGTTTAACAACTTCCAACATCAGGTTGACTATGCCGTGCACCATGCTTTGATCAATCAGTCTGGAATATTAGTCAA[T/C]
ACTTTGTCAAACATCGTGAAAACAATGGTTGATGGTTCAATGGCCGAGTATCAAGCTACAGGACCAGTTTATCTACCAGGAGGAATGTTCCCAAATTATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.90% | 1.00% | 21.84% | 29.22% | NA |
| All Indica | 2759 | 25.00% | 1.60% | 30.34% | 43.06% | NA |
| All Japonica | 1512 | 93.30% | 0.10% | 0.79% | 5.75% | NA |
| Aus | 269 | 5.90% | 0.40% | 63.57% | 30.11% | NA |
| Indica I | 595 | 14.50% | 0.30% | 22.69% | 62.52% | NA |
| Indica II | 465 | 21.90% | 1.90% | 36.77% | 39.35% | NA |
| Indica III | 913 | 35.00% | 1.90% | 32.09% | 31.00% | NA |
| Indica Intermediate | 786 | 23.20% | 2.00% | 30.28% | 44.53% | NA |
| Temperate Japonica | 767 | 95.20% | 0.30% | 0.52% | 4.04% | NA |
| Tropical Japonica | 504 | 94.40% | 0.00% | 0.60% | 4.96% | NA |
| Japonica Intermediate | 241 | 85.10% | 0.00% | 2.07% | 12.86% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 63.30% | 0.00% | 13.33% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813433527 | A -> G | LOC_Os08g22284.1 | synonymous_variant ; p.Asn221Asn; LOW | synonymous_codon | Average:10.569; most accessible tissue: Callus, score: 32.471 | N | N | N | N |
| vg0813433527 | A -> DEL | LOC_Os08g22284.1 | N | frameshift_variant | Average:10.569; most accessible tissue: Callus, score: 32.471 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813433527 | 6.11E-06 | 2.35E-10 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433527 | 2.48E-06 | 2.17E-07 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433527 | 3.34E-06 | 4.04E-06 | mr1070 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433527 | 2.85E-06 | 6.34E-07 | mr1128 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433527 | NA | 2.94E-09 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433527 | NA | 1.38E-07 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433527 | NA | 2.57E-08 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433527 | NA | 8.77E-08 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433527 | NA | 5.67E-06 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433527 | NA | 5.21E-07 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433527 | 9.73E-06 | 9.73E-06 | mr1250_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |