\
| Variant ID: vg0813433103 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13433103 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGCTGCTGAATCGGCTGAATGACCTGTTGCCTTAATGGCGTCTGCTGAATCGGTTGCAAAACCTGCCGTTTTGGTGGCGTTTGCTGAACTGGTTGCACAA[A/C]
CTGTTGGATTAGGTTTGTTTGTTGAATCGGCTGCACAACCTGCTGCCTTGGTGGTGTTTGTTAAGTCGGCTGCTGCTGGGCTGGATCAACAGTATGTTGA
TCAACATACTGTTGATCCAGCCCAGCAGCAGCCGACTTAACAAACACCACCAAGGCAGCAGGTTGTGCAGCCGATTCAACAAACAAACCTAATCCAACAG[T/G]
TTGTGCAACCAGTTCAGCAAACGCCACCAAAACGGCAGGTTTTGCAACCGATTCAGCAGACGCCATTAAGGCAACAGGTCATTCAGCCGATTCAGCAGCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.10% | 17.50% | 4.02% | 37.41% | NA |
| All Indica | 2759 | 12.40% | 29.10% | 3.19% | 55.35% | NA |
| All Japonica | 1512 | 93.30% | 0.50% | 0.33% | 5.89% | NA |
| Aus | 269 | 16.40% | 2.20% | 35.69% | 45.72% | NA |
| Indica I | 595 | 4.00% | 14.50% | 2.18% | 79.33% | NA |
| Indica II | 465 | 10.10% | 42.40% | 5.16% | 42.37% | NA |
| Indica III | 913 | 18.40% | 30.40% | 3.40% | 47.75% | NA |
| Indica Intermediate | 786 | 13.00% | 30.80% | 2.54% | 53.69% | NA |
| Temperate Japonica | 767 | 95.20% | 0.50% | 0.26% | 4.04% | NA |
| Tropical Japonica | 504 | 94.40% | 0.40% | 0.20% | 4.96% | NA |
| Japonica Intermediate | 241 | 84.60% | 0.80% | 0.83% | 13.69% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 61.10% | 10.00% | 1.11% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813433103 | A -> C | LOC_Os08g22284.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.22; most accessible tissue: Callus, score: 20.031 | N | N | N | N |
| vg0813433103 | A -> DEL | N | N | silent_mutation | Average:8.22; most accessible tissue: Callus, score: 20.031 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813433103 | 1.67E-06 | 1.12E-07 | mr1053 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433103 | NA | 5.11E-08 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433103 | NA | 9.80E-07 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433103 | NA | 5.90E-09 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433103 | NA | 2.21E-08 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433103 | NA | 2.72E-06 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813433103 | NA | 3.16E-09 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |