Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0813109769:

Variant ID: vg0813109769 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 13109769
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

AGATATGTTTAGGGCAAAAGTCTGCCATAAAGACTTATGGTATCTTAGAGTTTGTTAGAGATAAGAGTTGTGTCCGATATGGACATAGTTTCTAATTTTC[G/A]
GGTATAAATAGACCCCAAACCCCGTGTAATCAATTAACACACACATTCAATACAATTTCGGTGCATCGCCACCCTTTTGCTTTAGTTTTATTTCGACGAG

Reverse complement sequence

CTCGTCGAAATAAAACTAAAGCAAAAGGGTGGCGATGCACCGAAATTGTATTGAATGTGTGTGTTAATTGATTACACGGGGTTTGGGGTCTATTTATACC[C/T]
GAAAATTAGAAACTATGTCCATATCGGACACAACTCTTATCTCTAACAAACTCTAAGATACCATAAGTCTTTATGGCAGACTTTTGCCCTAAACATATCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.10%	30.80%	6.28%	10.85%	NA
All Indica	2759	84.80%	6.60%	7.07%	1.56%	NA
All Japonica	1512	2.40%	65.90%	3.37%	28.31%	NA
Aus	269	16.70%	82.90%	0.37%	0.00%	NA
Indica I	595	97.30%	0.50%	1.18%	1.01%	NA
Indica II	465	88.00%	6.90%	2.58%	2.58%	NA
Indica III	913	78.90%	6.00%	14.46%	0.66%	NA
Indica Intermediate	786	80.40%	11.60%	5.60%	2.42%	NA
Temperate Japonica	767	2.10%	88.00%	0.52%	9.39%	NA
Tropical Japonica	504	2.20%	42.10%	7.34%	48.41%	NA
Japonica Intermediate	241	3.70%	45.60%	4.15%	46.47%	NA
VI/Aromatic	96	6.20%	16.70%	45.83%	31.25%	NA
Intermediate	90	36.70%	43.30%	6.67%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0813109769	G -> A	LOC_Os08g21879.1	downstream_gene_variant ; 3129.0bp to feature; MODIFIER	silent_mutation	Average:40.558; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0813109769	G -> A	LOC_Os08g21890.1	downstream_gene_variant ; 1019.0bp to feature; MODIFIER	silent_mutation	Average:40.558; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0813109769	G -> A	LOC_Os08g21879-LOC_Os08g21890	intergenic_region ; MODIFIER	silent_mutation	Average:40.558; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0813109769	G -> DEL	N	N	silent_mutation	Average:40.558; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0813109769	NA	1.22E-07	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813109769	NA	7.19E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813109769	NA	5.83E-06	mr1484	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813109769	2.58E-06	NA	mr1560	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813109769	NA	1.38E-07	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813109769	3.85E-06	3.85E-06	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813109769	NA	2.41E-06	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813109769	NA	4.90E-08	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251