\
| Variant ID: vg0812798675 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12798675 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 116. )
CATCTAGGCTTTGACAAAACATGCAAAATTAATTTCAGGAACGCATTTCCTGATTTTAACAAGCGTATGTTTTGGCAAAGTATTTCGGGTCTCTCATCCT[A/G]
TAGAAAGCCTAGAACTAATGACATCCATAATCCTACCTTGAGGCTGTTGCATAAGTTGCTTGGTTTCACATCGTTTCTTAGAGCTGATATCCAGATAGCG
CGCTATCTGGATATCAGCTCTAAGAAACGATGTGAAACCAAGCAACTTATGCAACAGCCTCAAGGTAGGATTATGGATGTCATTAGTTCTAGGCTTTCTA[T/C]
AGGATGAGAGACCCGAAATACTTTGCCAAAACATACGCTTGTTAAAATCAGGAAATGCGTTCCTGAAATTAATTTTGCATGTTTTGTCAAAGCCTAGATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.50% | 7.90% | 4.78% | 44.82% | NA |
| All Indica | 2759 | 15.50% | 11.10% | 7.65% | 65.75% | NA |
| All Japonica | 1512 | 94.00% | 0.20% | 0.20% | 5.56% | NA |
| Aus | 269 | 3.70% | 22.70% | 4.09% | 69.52% | NA |
| Indica I | 595 | 12.30% | 4.20% | 6.39% | 77.14% | NA |
| Indica II | 465 | 11.40% | 11.20% | 6.67% | 70.75% | NA |
| Indica III | 913 | 18.90% | 12.50% | 8.32% | 60.24% | NA |
| Indica Intermediate | 786 | 16.30% | 14.80% | 8.40% | 60.56% | NA |
| Temperate Japonica | 767 | 95.40% | 0.30% | 0.26% | 4.04% | NA |
| Tropical Japonica | 504 | 94.20% | 0.00% | 0.00% | 5.75% | NA |
| Japonica Intermediate | 241 | 89.20% | 0.40% | 0.41% | 9.96% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 62.20% | 1.10% | 1.11% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812798675 | A -> G | LOC_Os08g21474.1 | upstream_gene_variant ; 337.0bp to feature; MODIFIER | silent_mutation | Average:15.109; most accessible tissue: Callus, score: 37.286 | N | N | N | N |
| vg0812798675 | A -> G | LOC_Os08g21480.1 | upstream_gene_variant ; 4069.0bp to feature; MODIFIER | silent_mutation | Average:15.109; most accessible tissue: Callus, score: 37.286 | N | N | N | N |
| vg0812798675 | A -> G | LOC_Os08g21460.1 | downstream_gene_variant ; 4891.0bp to feature; MODIFIER | silent_mutation | Average:15.109; most accessible tissue: Callus, score: 37.286 | N | N | N | N |
| vg0812798675 | A -> G | LOC_Os08g21470.1 | downstream_gene_variant ; 2091.0bp to feature; MODIFIER | silent_mutation | Average:15.109; most accessible tissue: Callus, score: 37.286 | N | N | N | N |
| vg0812798675 | A -> G | LOC_Os08g21470-LOC_Os08g21474 | intergenic_region ; MODIFIER | silent_mutation | Average:15.109; most accessible tissue: Callus, score: 37.286 | N | N | N | N |
| vg0812798675 | A -> DEL | N | N | silent_mutation | Average:15.109; most accessible tissue: Callus, score: 37.286 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812798675 | 4.30E-06 | NA | mr1238 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812798675 | NA | 4.20E-07 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812798675 | NA | 6.14E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812798675 | 3.41E-07 | 4.65E-21 | mr1566 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812798675 | NA | 1.78E-06 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812798675 | NA | 1.46E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812798675 | NA | 3.32E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812798675 | NA | 5.20E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812798675 | NA | 1.91E-19 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |