Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0812798675:

Variant ID: vg0812798675 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12798675
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

CATCTAGGCTTTGACAAAACATGCAAAATTAATTTCAGGAACGCATTTCCTGATTTTAACAAGCGTATGTTTTGGCAAAGTATTTCGGGTCTCTCATCCT[A/G]
TAGAAAGCCTAGAACTAATGACATCCATAATCCTACCTTGAGGCTGTTGCATAAGTTGCTTGGTTTCACATCGTTTCTTAGAGCTGATATCCAGATAGCG

Reverse complement sequence

CGCTATCTGGATATCAGCTCTAAGAAACGATGTGAAACCAAGCAACTTATGCAACAGCCTCAAGGTAGGATTATGGATGTCATTAGTTCTAGGCTTTCTA[T/C]
AGGATGAGAGACCCGAAATACTTTGCCAAAACATACGCTTGTTAAAATCAGGAAATGCGTTCCTGAAATTAATTTTGCATGTTTTGTCAAAGCCTAGATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.50%	7.90%	4.78%	44.82%	NA
All Indica	2759	15.50%	11.10%	7.65%	65.75%	NA
All Japonica	1512	94.00%	0.20%	0.20%	5.56%	NA
Aus	269	3.70%	22.70%	4.09%	69.52%	NA
Indica I	595	12.30%	4.20%	6.39%	77.14%	NA
Indica II	465	11.40%	11.20%	6.67%	70.75%	NA
Indica III	913	18.90%	12.50%	8.32%	60.24%	NA
Indica Intermediate	786	16.30%	14.80%	8.40%	60.56%	NA
Temperate Japonica	767	95.40%	0.30%	0.26%	4.04%	NA
Tropical Japonica	504	94.20%	0.00%	0.00%	5.75%	NA
Japonica Intermediate	241	89.20%	0.40%	0.41%	9.96%	NA
VI/Aromatic	96	95.80%	3.10%	0.00%	1.04%	NA
Intermediate	90	62.20%	1.10%	1.11%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812798675	A -> G	LOC_Os08g21474.1	upstream_gene_variant ; 337.0bp to feature; MODIFIER	silent_mutation	Average:15.109; most accessible tissue: Callus, score: 37.286	N	N	N	N
vg0812798675	A -> G	LOC_Os08g21480.1	upstream_gene_variant ; 4069.0bp to feature; MODIFIER	silent_mutation	Average:15.109; most accessible tissue: Callus, score: 37.286	N	N	N	N
vg0812798675	A -> G	LOC_Os08g21460.1	downstream_gene_variant ; 4891.0bp to feature; MODIFIER	silent_mutation	Average:15.109; most accessible tissue: Callus, score: 37.286	N	N	N	N
vg0812798675	A -> G	LOC_Os08g21470.1	downstream_gene_variant ; 2091.0bp to feature; MODIFIER	silent_mutation	Average:15.109; most accessible tissue: Callus, score: 37.286	N	N	N	N
vg0812798675	A -> G	LOC_Os08g21470-LOC_Os08g21474	intergenic_region ; MODIFIER	silent_mutation	Average:15.109; most accessible tissue: Callus, score: 37.286	N	N	N	N
vg0812798675	A -> DEL	N	N	silent_mutation	Average:15.109; most accessible tissue: Callus, score: 37.286	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812798675	4.30E-06	NA	mr1238	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675	NA	4.20E-07	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675	NA	6.14E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675	3.41E-07	4.65E-21	mr1566	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675	NA	1.78E-06	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675	NA	1.46E-13	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675	NA	3.32E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675	NA	5.20E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675	NA	1.91E-19	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251