\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812798675:

Variant ID: vg0812798675 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12798675
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CATCTAGGCTTTGACAAAACATGCAAAATTAATTTCAGGAACGCATTTCCTGATTTTAACAAGCGTATGTTTTGGCAAAGTATTTCGGGTCTCTCATCCT[A/G]
TAGAAAGCCTAGAACTAATGACATCCATAATCCTACCTTGAGGCTGTTGCATAAGTTGCTTGGTTTCACATCGTTTCTTAGAGCTGATATCCAGATAGCG

Reverse complement sequence

CGCTATCTGGATATCAGCTCTAAGAAACGATGTGAAACCAAGCAACTTATGCAACAGCCTCAAGGTAGGATTATGGATGTCATTAGTTCTAGGCTTTCTA[T/C]
AGGATGAGAGACCCGAAATACTTTGCCAAAACATACGCTTGTTAAAATCAGGAAATGCGTTCCTGAAATTAATTTTGCATGTTTTGTCAAAGCCTAGATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.50% 7.90% 4.78% 44.82% NA
All Indica  2759 15.50% 11.10% 7.65% 65.75% NA
All Japonica  1512 94.00% 0.20% 0.20% 5.56% NA
Aus  269 3.70% 22.70% 4.09% 69.52% NA
Indica I  595 12.30% 4.20% 6.39% 77.14% NA
Indica II  465 11.40% 11.20% 6.67% 70.75% NA
Indica III  913 18.90% 12.50% 8.32% 60.24% NA
Indica Intermediate  786 16.30% 14.80% 8.40% 60.56% NA
Temperate Japonica  767 95.40% 0.30% 0.26% 4.04% NA
Tropical Japonica  504 94.20% 0.00% 0.00% 5.75% NA
Japonica Intermediate  241 89.20% 0.40% 0.41% 9.96% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 62.20% 1.10% 1.11% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812798675 A -> G LOC_Os08g21474.1 upstream_gene_variant ; 337.0bp to feature; MODIFIER silent_mutation Average:15.109; most accessible tissue: Callus, score: 37.286 N N N N
vg0812798675 A -> G LOC_Os08g21480.1 upstream_gene_variant ; 4069.0bp to feature; MODIFIER silent_mutation Average:15.109; most accessible tissue: Callus, score: 37.286 N N N N
vg0812798675 A -> G LOC_Os08g21460.1 downstream_gene_variant ; 4891.0bp to feature; MODIFIER silent_mutation Average:15.109; most accessible tissue: Callus, score: 37.286 N N N N
vg0812798675 A -> G LOC_Os08g21470.1 downstream_gene_variant ; 2091.0bp to feature; MODIFIER silent_mutation Average:15.109; most accessible tissue: Callus, score: 37.286 N N N N
vg0812798675 A -> G LOC_Os08g21470-LOC_Os08g21474 intergenic_region ; MODIFIER silent_mutation Average:15.109; most accessible tissue: Callus, score: 37.286 N N N N
vg0812798675 A -> DEL N N silent_mutation Average:15.109; most accessible tissue: Callus, score: 37.286 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812798675 4.30E-06 NA mr1238 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675 NA 4.20E-07 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675 NA 6.14E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675 3.41E-07 4.65E-21 mr1566 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675 NA 1.78E-06 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675 NA 1.46E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675 NA 3.32E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675 NA 5.20E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798675 NA 1.91E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251