Variant ID: vg0812679480 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 12679480 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 227. )
TACAAAGCTTACAAAAGAGAAGAGGAAAGCTGCTAAAGCCATACCCGAACTCTTCCGAAGGTTTCCGGACTCCTGACTCCTATTCTATTTCTATTCCACC[A/T]
GCTAGATACTACTAAACTAAACTTGAGAGAAATGAGAGAGCTATTGCTTGAGGTGTGTGTTGAAATGAAGAGAGTGAAGCCTTTATATAGAGGTGGTTAT
ATAACCACCTCTATATAAAGGCTTCACTCTCTTCATTTCAACACACACCTCAAGCAATAGCTCTCTCATTTCTCTCAAGTTTAGTTTAGTAGTATCTAGC[T/A]
GGTGGAATAGAAATAGAATAGGAGTCAGGAGTCCGGAAACCTTCGGAAGAGTTCGGGTATGGCTTTAGCAGCTTTCCTCTTCTCTTTTGTAAGCTTTGTA
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 91.60% | 1.10% | 1.61% | 5.63% | NA |
All Indica | 2759 | 90.60% | 1.80% | 2.54% | 5.00% | NA |
All Japonica | 1512 | 92.10% | 0.00% | 0.20% | 7.67% | NA |
Aus | 269 | 98.90% | 0.00% | 0.74% | 0.37% | NA |
Indica I | 595 | 97.30% | 0.70% | 1.34% | 0.67% | NA |
Indica II | 465 | 94.80% | 2.20% | 1.29% | 1.72% | NA |
Indica III | 913 | 83.20% | 2.00% | 3.94% | 10.84% | NA |
Indica Intermediate | 786 | 91.60% | 2.40% | 2.54% | 3.44% | NA |
Temperate Japonica | 767 | 99.10% | 0.00% | 0.13% | 0.78% | NA |
Tropical Japonica | 504 | 86.10% | 0.00% | 0.00% | 13.89% | NA |
Japonica Intermediate | 241 | 82.60% | 0.00% | 0.83% | 16.60% | NA |
VI/Aromatic | 96 | 93.80% | 0.00% | 0.00% | 6.25% | NA |
Intermediate | 90 | 91.10% | 2.20% | 1.11% | 5.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0812679480 | A -> T | LOC_Os08g21230.1 | upstream_gene_variant ; 2484.0bp to feature; MODIFIER | silent_mutation | Average:16.641; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
vg0812679480 | A -> T | LOC_Os08g21230-LOC_Os08g21240 | intergenic_region ; MODIFIER | silent_mutation | Average:16.641; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
vg0812679480 | A -> DEL | N | N | silent_mutation | Average:16.641; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0812679480 | 1.24E-08 | 5.86E-11 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812679480 | 3.61E-09 | 1.35E-10 | mr1309 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812679480 | 5.30E-07 | 1.70E-10 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812679480 | 3.54E-11 | 3.54E-11 | mr1900 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812679480 | NA | 9.87E-07 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812679480 | NA | 1.60E-08 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812679480 | NA | 3.10E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |