\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812621693:

Variant ID: vg0812621693 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12621693
Reference Allele: GAlternative Allele: A,C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, C: 0.05, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCCTGTGCCGAAAGCTACCAGCAATTGCGCTTGGCCTAGAACTTGGACTGACTCACCGCCGAAACCACGGAGCGATGCCGATGCTTGGGTAAGGGCTA[G/A,C]
GGTCGGTAATCCCATCTTGGCATATGCTCCAGCGAAGATGACATCGGCCGAACTCCCTCCGTCGACTAAGATTCGTTGGACCTCGAAGCCAGCTATCTCG

Reverse complement sequence

CGAGATAGCTGGCTTCGAGGTCCAACGAATCTTAGTCGACGGAGGGAGTTCGGCCGATGTCATCTTCGCTGGAGCATATGCCAAGATGGGATTACCGACC[C/T,G]
TAGCCCTTACCCAAGCATCGGCATCGCTCCGTGGTTTCGGCGGTGAGTCAGTCCAAGTTCTAGGCCAAGCGCAATTGCTGGTAGCTTTCGGCACAGGCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.20% 41.50% 3.13% 4.53% A: 0.66%
All Indica  2759 81.50% 14.70% 2.14% 0.98% A: 0.65%
All Japonica  1512 2.80% 82.70% 4.23% 9.72% A: 0.60%
Aus  269 16.40% 60.60% 7.81% 14.13% A: 1.12%
Indica I  595 96.30% 2.50% 0.67% 0.34% A: 0.17%
Indica II  465 85.80% 12.30% 1.29% 0.43% A: 0.22%
Indica III  913 72.40% 21.80% 3.94% 1.31% A: 0.55%
Indica Intermediate  786 78.40% 17.20% 1.65% 1.40% A: 1.40%
Temperate Japonica  767 2.20% 92.20% 1.56% 4.04% NA
Tropical Japonica  504 3.00% 66.30% 8.93% 20.24% A: 1.59%
Japonica Intermediate  241 4.10% 86.70% 2.90% 5.81% A: 0.41%
VI/Aromatic  96 4.20% 94.80% 0.00% 1.04% NA
Intermediate  90 37.80% 55.60% 4.44% 1.11% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812621693 G -> C LOC_Os08g21110.1 missense_variant ; p.Leu6Val; MODERATE nonsynonymous_codon ; L6V Average:66.078; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 benign 1.306 TOLERATED 0.16
vg0812621693 G -> A LOC_Os08g21110.1 synonymous_variant ; p.Leu6Leu; LOW synonymous_codon Average:66.078; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg0812621693 G -> DEL LOC_Os08g21110.1 N frameshift_variant Average:66.078; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0812621693 G A -0.03 -0.03 -0.03 -0.02 -0.02 -0.02
vg0812621693 G C -0.02 -0.02 -0.02 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812621693 NA 6.55E-06 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812621693 NA 4.49E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812621693 NA 7.49E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812621693 NA 9.19E-25 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812621693 NA 1.01E-06 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812621693 NA 2.68E-12 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812621693 NA 1.61E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812621693 3.99E-06 3.49E-09 mr1632_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251