Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0812039331:

Variant ID: vg0812039331 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12039331
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGCTTATCTGGGAGATGCTTTGGTGCGGGTATAATGTTTGCATATGCAATTTCTCTATGTCATGACGATGATATTAGAGTAGTATCTGGTAGTTTAGA[C/T]
GTGGTGTCTAGATTATGGGATATCATTATTTGGGGTTATATGCTACGGATGAGAGGTGGGTCGCTGATGGTGACAGCTCAGTACGGGTATTCCTCCGCAC

Reverse complement sequence

GTGCGGAGGAATACCCGTACTGAGCTGTCACCATCAGCGACCCACCTCTCATCCGTAGCATATAACCCCAAATAATGATATCCCATAATCTAGACACCAC[G/A]
TCTAAACTACCAGATACTACTCTAATATCATCGTCATGACATAGAGAAATTGCATATGCAAACATTATACCCGCACCAAAGCATCTCCCAGATAAGCTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.90%	4.20%	4.74%	50.08%	NA
All Indica	2759	15.90%	2.60%	4.46%	76.98%	NA
All Japonica	1512	88.40%	1.30%	5.89%	4.43%	NA
Aus	269	4.80%	38.30%	2.60%	54.28%	NA
Indica I	595	7.60%	0.80%	3.87%	87.73%	NA
Indica II	465	15.10%	0.00%	2.58%	82.37%	NA
Indica III	913	22.20%	3.40%	6.46%	67.91%	NA
Indica Intermediate	786	15.40%	4.70%	3.69%	76.21%	NA
Temperate Japonica	767	95.30%	0.40%	0.65%	3.65%	NA
Tropical Japonica	504	79.80%	1.80%	13.29%	5.16%	NA
Japonica Intermediate	241	84.60%	2.90%	7.05%	5.39%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	58.90%	5.60%	5.56%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812039331	C -> T	LOC_Os08g20070.1	upstream_gene_variant ; 4154.0bp to feature; MODIFIER	silent_mutation	Average:21.194; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0812039331	C -> T	LOC_Os08g20090.2	upstream_gene_variant ; 4011.0bp to feature; MODIFIER	silent_mutation	Average:21.194; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0812039331	C -> T	LOC_Os08g20080.1	downstream_gene_variant ; 1433.0bp to feature; MODIFIER	silent_mutation	Average:21.194; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0812039331	C -> T	LOC_Os08g20080-LOC_Os08g20090	intergenic_region ; MODIFIER	silent_mutation	Average:21.194; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0812039331	C -> DEL	N	N	silent_mutation	Average:21.194; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812039331	NA	8.61E-10	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812039331	NA	5.10E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812039331	NA	7.13E-11	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812039331	NA	7.33E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812039331	NA	6.61E-11	mr1989	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251