\
| Variant ID: vg0812039331 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12039331 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 236. )
CTAGCTTATCTGGGAGATGCTTTGGTGCGGGTATAATGTTTGCATATGCAATTTCTCTATGTCATGACGATGATATTAGAGTAGTATCTGGTAGTTTAGA[C/T]
GTGGTGTCTAGATTATGGGATATCATTATTTGGGGTTATATGCTACGGATGAGAGGTGGGTCGCTGATGGTGACAGCTCAGTACGGGTATTCCTCCGCAC
GTGCGGAGGAATACCCGTACTGAGCTGTCACCATCAGCGACCCACCTCTCATCCGTAGCATATAACCCCAAATAATGATATCCCATAATCTAGACACCAC[G/A]
TCTAAACTACCAGATACTACTCTAATATCATCGTCATGACATAGAGAAATTGCATATGCAAACATTATACCCGCACCAAAGCATCTCCCAGATAAGCTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.90% | 4.20% | 4.74% | 50.08% | NA |
| All Indica | 2759 | 15.90% | 2.60% | 4.46% | 76.98% | NA |
| All Japonica | 1512 | 88.40% | 1.30% | 5.89% | 4.43% | NA |
| Aus | 269 | 4.80% | 38.30% | 2.60% | 54.28% | NA |
| Indica I | 595 | 7.60% | 0.80% | 3.87% | 87.73% | NA |
| Indica II | 465 | 15.10% | 0.00% | 2.58% | 82.37% | NA |
| Indica III | 913 | 22.20% | 3.40% | 6.46% | 67.91% | NA |
| Indica Intermediate | 786 | 15.40% | 4.70% | 3.69% | 76.21% | NA |
| Temperate Japonica | 767 | 95.30% | 0.40% | 0.65% | 3.65% | NA |
| Tropical Japonica | 504 | 79.80% | 1.80% | 13.29% | 5.16% | NA |
| Japonica Intermediate | 241 | 84.60% | 2.90% | 7.05% | 5.39% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 58.90% | 5.60% | 5.56% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812039331 | C -> T | LOC_Os08g20070.1 | upstream_gene_variant ; 4154.0bp to feature; MODIFIER | silent_mutation | Average:21.194; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0812039331 | C -> T | LOC_Os08g20090.2 | upstream_gene_variant ; 4011.0bp to feature; MODIFIER | silent_mutation | Average:21.194; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0812039331 | C -> T | LOC_Os08g20080.1 | downstream_gene_variant ; 1433.0bp to feature; MODIFIER | silent_mutation | Average:21.194; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0812039331 | C -> T | LOC_Os08g20080-LOC_Os08g20090 | intergenic_region ; MODIFIER | silent_mutation | Average:21.194; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0812039331 | C -> DEL | N | N | silent_mutation | Average:21.194; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812039331 | NA | 8.61E-10 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812039331 | NA | 5.10E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812039331 | NA | 7.13E-11 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812039331 | NA | 7.33E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812039331 | NA | 6.61E-11 | mr1989 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |