Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0812016473:

Variant ID: vg0812016473 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12016473
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

AGGAAAAGAGCTAGTTTGCGAAAATTCATAAAAATCCCATGAGTCTGGCAGAGAAGCAAGAAGGACTGGAATCAAGATTGTTCCATTTATCAATTACTCA[A/G]
GATGGTAAGATAGCCACTGATAAAGTTCACAGGTGCATGTATGGTTGTGAATGATTTATATGCTTGATTCATCTCTTGAAGAAATTCATTCTACACTAAC

Reverse complement sequence

GTTAGTGTAGAATGAATTTCTTCAAGAGATGAATCAAGCATATAAATCATTCACAACCATACATGCACCTGTGAACTTTATCAGTGGCTATCTTACCATC[T/C]
TGAGTAATTGATAAATGGAACAATCTTGATTCCAGTCCTTCTTGCTTCTCTGCCAGACTCATGGGATTTTTATGAATTTTCGCAAACTAGCTCTTTTCCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.10%	0.20%	1.44%	8.27%	NA
All Indica	2759	92.80%	0.20%	1.78%	5.22%	NA
All Japonica	1512	92.20%	0.10%	0.46%	7.28%	NA
Aus	269	49.10%	0.40%	4.09%	46.47%	NA
Indica I	595	92.80%	0.50%	2.52%	4.20%	NA
Indica II	465	89.20%	0.40%	2.15%	8.17%	NA
Indica III	913	94.50%	0.00%	0.88%	4.60%	NA
Indica Intermediate	786	92.90%	0.10%	2.04%	4.96%	NA
Temperate Japonica	767	97.70%	0.00%	0.26%	2.09%	NA
Tropical Japonica	504	85.10%	0.20%	0.99%	13.69%	NA
Japonica Intermediate	241	89.60%	0.00%	0.00%	10.37%	NA
VI/Aromatic	96	97.90%	0.00%	1.04%	1.04%	NA
Intermediate	90	87.80%	0.00%	0.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812016473	A -> G	LOC_Os08g20050.1	downstream_gene_variant ; 1391.0bp to feature; MODIFIER	silent_mutation	Average:16.917; most accessible tissue: Callus, score: 43.644	N	N	N	N
vg0812016473	A -> G	LOC_Os08g20050-LOC_Os08g20060	intergenic_region ; MODIFIER	silent_mutation	Average:16.917; most accessible tissue: Callus, score: 43.644	N	N	N	N
vg0812016473	A -> DEL	N	N	silent_mutation	Average:16.917; most accessible tissue: Callus, score: 43.644	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812016473	NA	1.26E-06	mr1045_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812016473	NA	9.69E-06	mr1105_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812016473	NA	5.15E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812016473	NA	9.89E-08	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812016473	NA	2.24E-06	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251