\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812016101:

Variant ID: vg0812016101 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12016101
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGCTCTCAAAACATTGAGCGAAGTTGAAAAGAAAATATAGCCATGCCCCTTCCATGATCATGCCAAGAGAACAAAATGGAGAGAAAGTATAGGAAAAA[A/G]
GGAGAATAAATTTTTCCATCATTCCACAATATATTTTACGTTTTCATTTTCCACCACAAATAAAAACCCTTGATCTAAGAGCATGATTGATGATCTTCTT

Reverse complement sequence

AAGAAGATCATCAATCATGCTCTTAGATCAAGGGTTTTTATTTGTGGTGGAAAATGAAAACGTAAAATATATTGTGGAATGATGGAAAAATTTATTCTCC[T/C]
TTTTTCCTATACTTTCTCTCCATTTTGTTCTCTTGGCATGATCATGGAAGGGGCATGGCTATATTTTCTTTTCAACTTCGCTCAATGTTTTGAGAGCAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.30% 5.80% 1.57% 52.29% NA
All Indica  2759 16.80% 9.70% 1.78% 71.66% NA
All Japonica  1512 84.70% 0.10% 0.33% 14.88% NA
Aus  269 8.60% 1.10% 7.43% 82.90% NA
Indica I  595 35.80% 2.70% 1.01% 60.50% NA
Indica II  465 17.40% 5.60% 2.15% 74.84% NA
Indica III  913 3.00% 17.60% 1.64% 77.77% NA
Indica Intermediate  786 18.20% 8.40% 2.29% 71.12% NA
Temperate Japonica  767 96.00% 0.00% 0.26% 3.78% NA
Tropical Japonica  504 68.50% 0.20% 0.20% 31.15% NA
Japonica Intermediate  241 83.00% 0.00% 0.83% 16.18% NA
VI/Aromatic  96 88.50% 0.00% 0.00% 11.46% NA
Intermediate  90 58.90% 2.20% 0.00% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812016101 A -> G LOC_Os08g20050.1 downstream_gene_variant ; 1019.0bp to feature; MODIFIER silent_mutation Average:12.742; most accessible tissue: Callus, score: 25.742 N N N N
vg0812016101 A -> G LOC_Os08g20050-LOC_Os08g20060 intergenic_region ; MODIFIER silent_mutation Average:12.742; most accessible tissue: Callus, score: 25.742 N N N N
vg0812016101 A -> DEL N N silent_mutation Average:12.742; most accessible tissue: Callus, score: 25.742 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812016101 7.54E-09 3.50E-11 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812016101 2.59E-08 3.52E-10 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812016101 4.39E-10 2.30E-13 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812016101 3.86E-11 3.86E-11 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812016101 1.30E-07 1.89E-09 mr1238_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812016101 2.60E-06 5.75E-08 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812016101 6.37E-06 NA mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812016101 1.91E-07 5.75E-11 mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812016101 4.50E-07 4.32E-09 mr1900_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251