| Variant ID: vg0812016101 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12016101 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 107. )
TTTGCTCTCAAAACATTGAGCGAAGTTGAAAAGAAAATATAGCCATGCCCCTTCCATGATCATGCCAAGAGAACAAAATGGAGAGAAAGTATAGGAAAAA[A/G]
GGAGAATAAATTTTTCCATCATTCCACAATATATTTTACGTTTTCATTTTCCACCACAAATAAAAACCCTTGATCTAAGAGCATGATTGATGATCTTCTT
AAGAAGATCATCAATCATGCTCTTAGATCAAGGGTTTTTATTTGTGGTGGAAAATGAAAACGTAAAATATATTGTGGAATGATGGAAAAATTTATTCTCC[T/C]
TTTTTCCTATACTTTCTCTCCATTTTGTTCTCTTGGCATGATCATGGAAGGGGCATGGCTATATTTTCTTTTCAACTTCGCTCAATGTTTTGAGAGCAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.30% | 5.80% | 1.57% | 52.29% | NA |
| All Indica | 2759 | 16.80% | 9.70% | 1.78% | 71.66% | NA |
| All Japonica | 1512 | 84.70% | 0.10% | 0.33% | 14.88% | NA |
| Aus | 269 | 8.60% | 1.10% | 7.43% | 82.90% | NA |
| Indica I | 595 | 35.80% | 2.70% | 1.01% | 60.50% | NA |
| Indica II | 465 | 17.40% | 5.60% | 2.15% | 74.84% | NA |
| Indica III | 913 | 3.00% | 17.60% | 1.64% | 77.77% | NA |
| Indica Intermediate | 786 | 18.20% | 8.40% | 2.29% | 71.12% | NA |
| Temperate Japonica | 767 | 96.00% | 0.00% | 0.26% | 3.78% | NA |
| Tropical Japonica | 504 | 68.50% | 0.20% | 0.20% | 31.15% | NA |
| Japonica Intermediate | 241 | 83.00% | 0.00% | 0.83% | 16.18% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 0.00% | 11.46% | NA |
| Intermediate | 90 | 58.90% | 2.20% | 0.00% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812016101 | A -> G | LOC_Os08g20050.1 | downstream_gene_variant ; 1019.0bp to feature; MODIFIER | silent_mutation | Average:12.742; most accessible tissue: Callus, score: 25.742 | N | N | N | N |
| vg0812016101 | A -> G | LOC_Os08g20050-LOC_Os08g20060 | intergenic_region ; MODIFIER | silent_mutation | Average:12.742; most accessible tissue: Callus, score: 25.742 | N | N | N | N |
| vg0812016101 | A -> DEL | N | N | silent_mutation | Average:12.742; most accessible tissue: Callus, score: 25.742 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812016101 | 7.54E-09 | 3.50E-11 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016101 | 2.59E-08 | 3.52E-10 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016101 | 4.39E-10 | 2.30E-13 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016101 | 3.86E-11 | 3.86E-11 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016101 | 1.30E-07 | 1.89E-09 | mr1238_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016101 | 2.60E-06 | 5.75E-08 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016101 | 6.37E-06 | NA | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016101 | 1.91E-07 | 5.75E-11 | mr1841_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016101 | 4.50E-07 | 4.32E-09 | mr1900_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |