| Variant ID: vg0812003263 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12003263 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCAACCACGCTGAGGAAGAGGCTACTTGGGAACGTGAAGACGAGCTGAAGGCAGCCCATCCCGATCACTTCGCCAGTTCTTCCGAATCTCGGGGTCGAGA[T/A]
TCCGTTTAAGGGGGGTAGGTTTGTCACGTCCCAAAACGACTCTAAAATATATCCTTTAAATTATGCCTAGAATAATTAAACTCCGTGTGAAAGCCTCCAA
TTGGAGGCTTTCACACGGAGTTTAATTATTCTAGGCATAATTTAAAGGATATATTTTAGAGTCGTTTTGGGACGTGACAAACCTACCCCCCTTAAACGGA[A/T]
TCTCGACCCCGAGATTCGGAAGAACTGGCGAAGTGATCGGGATGGGCTGCCTTCAGCTCGTCTTCACGTTCCCAAGTAGCCTCTTCCTCAGCGTGGTTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.20% | 4.60% | 2.43% | 3.77% | NA |
| All Indica | 2759 | 99.70% | 0.00% | 0.18% | 0.07% | NA |
| All Japonica | 1512 | 73.50% | 10.50% | 5.36% | 10.58% | NA |
| Aus | 269 | 97.00% | 0.00% | 1.49% | 1.49% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.60% | 0.10% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 97.00% | 1.80% | 0.13% | 1.04% | NA |
| Tropical Japonica | 504 | 48.60% | 18.30% | 10.71% | 22.42% | NA |
| Japonica Intermediate | 241 | 51.00% | 22.00% | 10.79% | 16.18% | NA |
| VI/Aromatic | 96 | 24.00% | 51.00% | 19.79% | 5.21% | NA |
| Intermediate | 90 | 76.70% | 8.90% | 6.67% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812003263 | T -> A | LOC_Os08g20030.1 | downstream_gene_variant ; 188.0bp to feature; MODIFIER | silent_mutation | Average:12.501; most accessible tissue: Callus, score: 24.107 | N | N | N | N |
| vg0812003263 | T -> A | LOC_Os08g20030-LOC_Os08g20040 | intergenic_region ; MODIFIER | silent_mutation | Average:12.501; most accessible tissue: Callus, score: 24.107 | N | N | N | N |
| vg0812003263 | T -> DEL | N | N | silent_mutation | Average:12.501; most accessible tissue: Callus, score: 24.107 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812003263 | 1.12E-06 | 4.81E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812003263 | 3.50E-07 | NA | mr1118_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812003263 | 5.62E-06 | NA | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812003263 | 4.21E-07 | NA | mr1123_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812003263 | 1.22E-06 | NA | mr1242_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812003263 | 4.95E-07 | 5.26E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812003263 | 7.20E-06 | NA | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |