\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811826340:

Variant ID: vg0811826340 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 11826340
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAATGATGCTGTAATAGGTAATAACTTGTTTAGCTCCTGGTTTGGAATGGTATATTCCTGGTTTGGAGATAGAACTGTGCAGCCGCGATTGGTTGTT[C/T]
AGAGTGGTTGGGCCTATGCAACAGGGTATGTTGTATAGCGTTGGATTAATATTGTTTAATTAAATACTCTATTGTTTTATTAAATTCTGAAATATTTCTT

Reverse complement sequence

AAGAAATATTTCAGAATTTAATAAAACAATAGAGTATTTAATTAAACAATATTAATCCAACGCTATACAACATACCCTGTTGCATAGGCCCAACCACTCT[G/A]
AACAACCAATCGCGGCTGCACAGTTCTATCTCCAAACCAGGAATATACCATTCCAAACCAGGAGCTAAACAAGTTATTACCTATTACAGCATCATTTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 5.20% 3.94% 7.58% NA
All Indica  2759 90.80% 8.60% 0.58% 0.07% NA
All Japonica  1512 70.90% 0.30% 9.06% 19.71% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 97.60% 2.20% 0.17% 0.00% NA
Indica II  465 95.30% 4.50% 0.00% 0.22% NA
Indica III  913 83.50% 15.40% 1.10% 0.00% NA
Indica Intermediate  786 91.50% 7.80% 0.64% 0.13% NA
Temperate Japonica  767 91.30% 0.00% 3.26% 5.48% NA
Tropical Japonica  504 47.60% 1.00% 15.28% 36.11% NA
Japonica Intermediate  241 54.80% 0.00% 14.52% 30.71% NA
VI/Aromatic  96 22.90% 3.10% 25.00% 48.96% NA
Intermediate  90 76.70% 2.20% 8.89% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0811826340 C -> T LOC_Os08g19760.1 upstream_gene_variant ; 3423.0bp to feature; MODIFIER silent_mutation Average:47.987; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg0811826340 C -> T LOC_Os08g19750.1 intron_variant ; MODIFIER silent_mutation Average:47.987; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg0811826340 C -> DEL N N silent_mutation Average:47.987; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0811826340 1.65E-06 8.55E-09 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811826340 5.49E-07 1.99E-08 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811826340 1.95E-06 NA mr1733 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811826340 1.61E-07 4.73E-10 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811826340 1.85E-09 1.85E-09 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811826340 2.62E-06 2.03E-08 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811826340 4.17E-06 6.69E-08 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811826340 4.90E-06 NA mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811826340 5.59E-06 2.42E-09 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811826340 NA 2.14E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251