\
| Variant ID: vg0811826340 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 11826340 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAAAATGATGCTGTAATAGGTAATAACTTGTTTAGCTCCTGGTTTGGAATGGTATATTCCTGGTTTGGAGATAGAACTGTGCAGCCGCGATTGGTTGTT[C/T]
AGAGTGGTTGGGCCTATGCAACAGGGTATGTTGTATAGCGTTGGATTAATATTGTTTAATTAAATACTCTATTGTTTTATTAAATTCTGAAATATTTCTT
AAGAAATATTTCAGAATTTAATAAAACAATAGAGTATTTAATTAAACAATATTAATCCAACGCTATACAACATACCCTGTTGCATAGGCCCAACCACTCT[G/A]
AACAACCAATCGCGGCTGCACAGTTCTATCTCCAAACCAGGAATATACCATTCCAAACCAGGAGCTAAACAAGTTATTACCTATTACAGCATCATTTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.30% | 5.20% | 3.94% | 7.58% | NA |
| All Indica | 2759 | 90.80% | 8.60% | 0.58% | 0.07% | NA |
| All Japonica | 1512 | 70.90% | 0.30% | 9.06% | 19.71% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.50% | 0.00% | 0.22% | NA |
| Indica III | 913 | 83.50% | 15.40% | 1.10% | 0.00% | NA |
| Indica Intermediate | 786 | 91.50% | 7.80% | 0.64% | 0.13% | NA |
| Temperate Japonica | 767 | 91.30% | 0.00% | 3.26% | 5.48% | NA |
| Tropical Japonica | 504 | 47.60% | 1.00% | 15.28% | 36.11% | NA |
| Japonica Intermediate | 241 | 54.80% | 0.00% | 14.52% | 30.71% | NA |
| VI/Aromatic | 96 | 22.90% | 3.10% | 25.00% | 48.96% | NA |
| Intermediate | 90 | 76.70% | 2.20% | 8.89% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0811826340 | C -> T | LOC_Os08g19760.1 | upstream_gene_variant ; 3423.0bp to feature; MODIFIER | silent_mutation | Average:47.987; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg0811826340 | C -> T | LOC_Os08g19750.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.987; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg0811826340 | C -> DEL | N | N | silent_mutation | Average:47.987; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0811826340 | 1.65E-06 | 8.55E-09 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811826340 | 5.49E-07 | 1.99E-08 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811826340 | 1.95E-06 | NA | mr1733 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811826340 | 1.61E-07 | 4.73E-10 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811826340 | 1.85E-09 | 1.85E-09 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811826340 | 2.62E-06 | 2.03E-08 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811826340 | 4.17E-06 | 6.69E-08 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811826340 | 4.90E-06 | NA | mr1733_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811826340 | 5.59E-06 | 2.42E-09 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811826340 | NA | 2.14E-07 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |