\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811525476:

Variant ID: vg0811525476 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 11525476
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTAACTGATGCAGCACTAAGTATGAAAAAAAACATAATATCTAGACAATCAAGCCATTGACTGAGTTTTCAGGGTGGTAGATGTCTAAGCTAATCTAAT[C/A]
TAGCAACGCGATTTAGCCGATACTGGCAGAAACCCTAAAACGAGAAGCAGCCGATAGAGCTAAATTGAGATGCTAGGACTAGATTAACATAGACATATGA

Reverse complement sequence

TCATATGTCTATGTTAATCTAGTCCTAGCATCTCAATTTAGCTCTATCGGCTGCTTCTCGTTTTAGGGTTTCTGCCAGTATCGGCTAAATCGCGTTGCTA[G/T]
ATTAGATTAGCTTAGACATCTACCACCCTGAAAACTCAGTCAATGGCTTGATTGTCTAGATATTATGTTTTTTTTCATACTTAGTGCTGCATCAGTTAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.30% 17.60% 0.11% 0.00% NA
All Indica  2759 91.20% 8.70% 0.07% 0.00% NA
All Japonica  1512 67.70% 32.30% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 84.20% 15.60% 0.22% 0.00% NA
Indica Intermediate  786 92.00% 8.00% 0.00% 0.00% NA
Temperate Japonica  767 90.00% 10.00% 0.00% 0.00% NA
Tropical Japonica  504 42.30% 57.70% 0.00% 0.00% NA
Japonica Intermediate  241 49.80% 50.20% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 82.30% 2.08% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0811525476 C -> A LOC_Os08g19260.1 upstream_gene_variant ; 3380.0bp to feature; MODIFIER silent_mutation Average:36.546; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg0811525476 C -> A LOC_Os08g19270.1 downstream_gene_variant ; 783.0bp to feature; MODIFIER silent_mutation Average:36.546; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg0811525476 C -> A LOC_Os08g19260-LOC_Os08g19270 intergenic_region ; MODIFIER silent_mutation Average:36.546; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0811525476 NA 1.13E-09 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811525476 NA 8.49E-07 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811525476 NA 1.90E-06 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811525476 NA 1.95E-08 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811525476 1.55E-07 1.23E-11 mr1238_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811525476 3.67E-07 4.89E-11 mr1484_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811525476 2.35E-06 1.87E-12 mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811525476 NA 4.11E-09 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251