\
| Variant ID: vg0811525476 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 11525476 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTTAACTGATGCAGCACTAAGTATGAAAAAAAACATAATATCTAGACAATCAAGCCATTGACTGAGTTTTCAGGGTGGTAGATGTCTAAGCTAATCTAAT[C/A]
TAGCAACGCGATTTAGCCGATACTGGCAGAAACCCTAAAACGAGAAGCAGCCGATAGAGCTAAATTGAGATGCTAGGACTAGATTAACATAGACATATGA
TCATATGTCTATGTTAATCTAGTCCTAGCATCTCAATTTAGCTCTATCGGCTGCTTCTCGTTTTAGGGTTTCTGCCAGTATCGGCTAAATCGCGTTGCTA[G/T]
ATTAGATTAGCTTAGACATCTACCACCCTGAAAACTCAGTCAATGGCTTGATTGTCTAGATATTATGTTTTTTTTCATACTTAGTGCTGCATCAGTTAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.30% | 17.60% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 91.20% | 8.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.20% | 15.60% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 42.30% | 57.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.80% | 50.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 82.30% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0811525476 | C -> A | LOC_Os08g19260.1 | upstream_gene_variant ; 3380.0bp to feature; MODIFIER | silent_mutation | Average:36.546; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg0811525476 | C -> A | LOC_Os08g19270.1 | downstream_gene_variant ; 783.0bp to feature; MODIFIER | silent_mutation | Average:36.546; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg0811525476 | C -> A | LOC_Os08g19260-LOC_Os08g19270 | intergenic_region ; MODIFIER | silent_mutation | Average:36.546; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0811525476 | NA | 1.13E-09 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811525476 | NA | 8.49E-07 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811525476 | NA | 1.90E-06 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811525476 | NA | 1.95E-08 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811525476 | 1.55E-07 | 1.23E-11 | mr1238_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811525476 | 3.67E-07 | 4.89E-11 | mr1484_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811525476 | 2.35E-06 | 1.87E-12 | mr1841_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811525476 | NA | 4.11E-09 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |