\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811122650:

Variant ID: vg0811122650 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 11122650
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGCTTGTGCACTTGACTTTGGCGGAGCTTGGGATAAAAGTCTACCATATGCTAAATTCTCTTACAATAACAGCTATCAGGCCAGTTTGCAAATGGCAC[C/A]
GTTTGAAGCATTGTACGGACGGAAGTGCCGCACTCCGCTCTTCTGGGATCAAACTGGAGAACGCCAACTGTTCGGGACAGAGGTGCTAACCGAGGCAGAG

Reverse complement sequence

CTCTGCCTCGGTTAGCACCTCTGTCCCGAACAGTTGGCGTTCTCCAGTTTGATCCCAGAAGAGCGGAGTGCGGCACTTCCGTCCGTACAATGCTTCAAAC[G/T]
GTGCCATTTGCAAACTGGCCTGATAGCTGTTATTGTAAGAGAATTTAGCATATGGTAGACTTTTATCCCAAGCTCCGCCAAAGTCAAGTGCACAAGCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.20% 4.10% 2.77% 0.87% NA
All Indica  2759 99.90% 0.10% 0.00% 0.04% NA
All Japonica  1512 76.70% 12.60% 8.13% 2.51% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 95.40% 0.50% 2.87% 1.17% NA
Tropical Japonica  504 48.80% 31.70% 16.67% 2.78% NA
Japonica Intermediate  241 75.50% 11.20% 7.05% 6.22% NA
VI/Aromatic  96 92.70% 0.00% 6.25% 1.04% NA
Intermediate  90 95.60% 1.10% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0811122650 C -> A LOC_Os08g18140.1 missense_variant ; p.Pro636Gln; MODERATE nonsynonymous_codon ; P636Q Average:44.832; most accessible tissue: Minghui63 young leaf, score: 71.839 probably damaging 2.377 DELETERIOUS 0.00
vg0811122650 C -> DEL LOC_Os08g18140.1 N frameshift_variant Average:44.832; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0811122650 1.57E-06 3.57E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 2.75E-09 6.08E-10 mr1083 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 1.99E-07 NA mr1086 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 7.06E-06 7.06E-06 mr1145 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 8.73E-08 8.73E-08 mr1204 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 4.45E-09 5.14E-09 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 5.43E-06 NA mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 2.17E-06 NA mr1560 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 2.02E-11 2.02E-11 mr1076_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 NA 8.00E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 NA 1.36E-10 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 NA 3.47E-06 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 NA 8.98E-08 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 3.00E-06 8.63E-08 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 NA 1.98E-09 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 2.37E-08 2.37E-08 mr1264_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 NA 1.27E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811122650 NA 8.84E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251