Variant ID: vg0810945945 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 10945945 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 250. )
ACTAGTGTAAATAAGATCTCTTGATAGTATTGTCCCCATTTTGGCTGATATGACGCCTACGTGGCTCTTTAGACTAAATCTTTGTCCCACGCGCATTGAC[G/T]
TGACGCTTACGTGGCAATTTGATCCGAAAAAAATAAAAGGAGAAAAATTAGAAAAAAATATGCGGGGCCATATGTCTAATGTCTACAAGAAGATAAAAAA
TTTTTTATCTTCTTGTAGACATTAGACATATGGCCCCGCATATTTTTTTCTAATTTTTCTCCTTTTATTTTTTTCGGATCAAATTGCCACGTAAGCGTCA[C/A]
GTCAATGCGCGTGGGACAAAGATTTAGTCTAAAGAGCCACGTAGGCGTCATATCAGCCAAAATGGGGACAATACTATCAAGAGATCTTATTTACACTAGT
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.80% | 5.20% | 0.06% | 0.00% | NA |
All Indica | 2759 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
Aus | 269 | 82.20% | 17.10% | 0.74% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 73.00% | 27.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0810945945 | G -> T | LOC_Os08g17850.1 | upstream_gene_variant ; 4173.0bp to feature; MODIFIER | silent_mutation | Average:61.154; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
vg0810945945 | G -> T | LOC_Os08g17830.1 | downstream_gene_variant ; 812.0bp to feature; MODIFIER | silent_mutation | Average:61.154; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
vg0810945945 | G -> T | LOC_Os08g17830-LOC_Os08g17850 | intergenic_region ; MODIFIER | silent_mutation | Average:61.154; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0810945945 | 7.02E-07 | NA | mr1134 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810945945 | NA | 9.03E-06 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810945945 | 2.91E-07 | NA | mr1504 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810945945 | NA | 1.15E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810945945 | 1.22E-07 | 3.29E-08 | mr1835 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |