\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810861351:

Variant ID: vg0810861351 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10861351
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCACCATTGCTTTCTCATAGGTAGTAGGTTCATCGTTGTCTAACAACAATATATCACGTTGTCCTGTAGTTAACAACGCATACCTCGCAGTTGTACACC[A/G,T]
TATCCTTTCGGACCTTCGTGAAGCCGGTGCTTCCACAACTAGTTCAACAACAACTTGTTCAACCTGTTGAACAACATCTTGCTTAGCTTGTGGTTGTGTG

Reverse complement sequence

CACACAACCACAAGCTAAGCAAGATGTTGTTCAACAGGTTGAACAAGTTGTTGTTGAACTAGTTGTGGAAGCACCGGCTTCACGAAGGTCCGAAAGGATA[T/C,A]
GGTGTACAACTGCGAGGTATGCGTTGTTAACTACAGGACAACGTGATATATTGTTGTTAGACAACGATGAACCTACTACCTATGAGAAAGCAATGGTGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 19.30% 10.20% 0.47% T: 0.04%
All Indica  2759 97.20% 1.60% 0.91% 0.22% T: 0.07%
All Japonica  1512 19.20% 55.50% 24.47% 0.86% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 98.50% 1.30% 0.00% 0.00% T: 0.17%
Indica II  465 94.60% 2.20% 2.80% 0.22% T: 0.22%
Indica III  913 97.40% 1.30% 0.88% 0.44% NA
Indica Intermediate  786 97.70% 1.70% 0.51% 0.13% NA
Temperate Japonica  767 12.80% 85.40% 1.83% 0.00% NA
Tropical Japonica  504 28.80% 21.00% 48.81% 1.39% NA
Japonica Intermediate  241 19.50% 32.40% 45.64% 2.49% NA
VI/Aromatic  96 16.70% 11.50% 69.79% 2.08% NA
Intermediate  90 56.70% 21.10% 21.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810861351 A -> G LOC_Os08g17750.1 missense_variant ; p.Trp881Arg; MODERATE nonsynonymous_codon ; W881R Average:13.628; most accessible tissue: Zhenshan97 flower, score: 21.513 unknown unknown TOLERATED 1.00
vg0810861351 A -> T LOC_Os08g17750.1 missense_variant ; p.Trp881Arg; MODERATE nonsynonymous_codon ; W881R Average:13.628; most accessible tissue: Zhenshan97 flower, score: 21.513 unknown unknown TOLERATED 1.00
vg0810861351 A -> DEL LOC_Os08g17750.1 N frameshift_variant Average:13.628; most accessible tissue: Zhenshan97 flower, score: 21.513 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810861351 NA 3.64E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0810861351 NA 9.22E-31 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 7.30E-07 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 1.13E-33 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 3.34E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 2.31E-06 mr1185_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 8.18E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 1.66E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 3.20E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 2.72E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 6.66E-06 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 1.99E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 1.90E-06 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 1.48E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 1.39E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 2.33E-23 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 3.52E-27 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 1.65E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 3.92E-07 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 1.61E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 1.07E-08 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 2.87E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 1.63E-06 mr1792_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 7.96E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 3.07E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 7.52E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 NA 6.28E-06 mr1912_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351 8.24E-06 8.22E-06 mr1919_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251