Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810861351:

Variant ID: vg0810861351 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10861351
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCACCATTGCTTTCTCATAGGTAGTAGGTTCATCGTTGTCTAACAACAATATATCACGTTGTCCTGTAGTTAACAACGCATACCTCGCAGTTGTACACC[A/G,T]
TATCCTTTCGGACCTTCGTGAAGCCGGTGCTTCCACAACTAGTTCAACAACAACTTGTTCAACCTGTTGAACAACATCTTGCTTAGCTTGTGGTTGTGTG

Reverse complement sequence

CACACAACCACAAGCTAAGCAAGATGTTGTTCAACAGGTTGAACAAGTTGTTGTTGAACTAGTTGTGGAAGCACCGGCTTCACGAAGGTCCGAAAGGATA[T/C,A]
GGTGTACAACTGCGAGGTATGCGTTGTTAACTACAGGACAACGTGATATATTGTTGTTAGACAACGATGAACCTACTACCTATGAGAAAGCAATGGTGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.00%	19.30%	10.20%	0.47%	T: 0.04%
All Indica	2759	97.20%	1.60%	0.91%	0.22%	T: 0.07%
All Japonica	1512	19.20%	55.50%	24.47%	0.86%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	98.50%	1.30%	0.00%	0.00%	T: 0.17%
Indica II	465	94.60%	2.20%	2.80%	0.22%	T: 0.22%
Indica III	913	97.40%	1.30%	0.88%	0.44%	NA
Indica Intermediate	786	97.70%	1.70%	0.51%	0.13%	NA
Temperate Japonica	767	12.80%	85.40%	1.83%	0.00%	NA
Tropical Japonica	504	28.80%	21.00%	48.81%	1.39%	NA
Japonica Intermediate	241	19.50%	32.40%	45.64%	2.49%	NA
VI/Aromatic	96	16.70%	11.50%	69.79%	2.08%	NA
Intermediate	90	56.70%	21.10%	21.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810861351	A -> G	LOC_Os08g17750.1	missense_variant ; p.Trp881Arg; MODERATE	nonsynonymous_codon ; W881R	Average:13.628; most accessible tissue: Zhenshan97 flower, score: 21.513	unknown	unknown	TOLERATED	1.00
vg0810861351	A -> T	LOC_Os08g17750.1	missense_variant ; p.Trp881Arg; MODERATE	nonsynonymous_codon ; W881R	Average:13.628; most accessible tissue: Zhenshan97 flower, score: 21.513	unknown	unknown	TOLERATED	1.00
vg0810861351	A -> DEL	LOC_Os08g17750.1	N	frameshift_variant	Average:13.628; most accessible tissue: Zhenshan97 flower, score: 21.513	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810861351	NA	3.64E-14	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0810861351	NA	9.22E-31	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	7.30E-07	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	1.13E-33	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	3.34E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	2.31E-06	mr1185_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	8.18E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	1.66E-06	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	3.20E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	2.72E-07	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	6.66E-06	mr1255_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	1.99E-06	mr1269_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	1.90E-06	mr1405_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	1.48E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	1.39E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	2.33E-23	mr1611_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	3.52E-27	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	1.65E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	3.92E-07	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	1.61E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	1.07E-08	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	2.87E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	1.63E-06	mr1792_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	7.96E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	3.07E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	7.52E-06	mr1892_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	NA	6.28E-06	mr1912_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810861351	8.24E-06	8.22E-06	mr1919_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251