\
| Variant ID: vg0810831297 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 10831297 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCGCCCTCCTGGTTGTCCGCGCACCATCTCAACCGGTCAACAAAGACTCTCCACTAGCTCTGTATTTAAGTTGAGACTTCTTCACTTAGATTTCCAAGGT[G/A]
GTATTATTACCCATAGCACTTAATGTGGGCCAATGGAATTTATTAGGATTTAATTGGTCCTAGTCCATTAATCTAACAATCCCCACCAAATATCATGGCT
AGCCATGATATTTGGTGGGGATTGTTAGATTAATGGACTAGGACCAATTAAATCCTAATAAATTCCATTGGCCCACATTAAGTGCTATGGGTAATAATAC[C/T]
ACCTTGGAAATCTAAGTGAAGAAGTCTCAACTTAAATACAGAGCTAGTGGAGAGTCTTTGTTGACCGGTTGAGATGGTGCGCGGACAACCAGGAGGGCGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.60% | 32.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 19.00% | 80.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 52.40% | 47.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 12.80% | 87.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 28.60% | 71.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 19.10% | 80.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 48.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0810831297 | G -> A | LOC_Os08g17690.1 | upstream_gene_variant ; 4890.0bp to feature; MODIFIER | silent_mutation | Average:33.88; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0810831297 | G -> A | LOC_Os08g17700.1 | downstream_gene_variant ; 664.0bp to feature; MODIFIER | silent_mutation | Average:33.88; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0810831297 | G -> A | LOC_Os08g17690-LOC_Os08g17700 | intergenic_region ; MODIFIER | silent_mutation | Average:33.88; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0810831297 | NA | 1.03E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | 4.73E-06 | NA | mr1949 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | NA | 7.47E-17 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | NA | 7.59E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | NA | 1.49E-06 | mr1075_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | NA | 5.03E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | NA | 9.21E-06 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | NA | 2.30E-07 | mr1149_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | NA | 6.14E-07 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | NA | 1.30E-06 | mr1405_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | NA | 6.44E-06 | mr1441_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | 2.82E-06 | 2.82E-06 | mr1592_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | NA | 8.98E-06 | mr1595_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | NA | 8.95E-06 | mr1600_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810831297 | NA | 9.18E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |