\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810831297:

Variant ID: vg0810831297 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10831297
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGCCCTCCTGGTTGTCCGCGCACCATCTCAACCGGTCAACAAAGACTCTCCACTAGCTCTGTATTTAAGTTGAGACTTCTTCACTTAGATTTCCAAGGT[G/A]
GTATTATTACCCATAGCACTTAATGTGGGCCAATGGAATTTATTAGGATTTAATTGGTCCTAGTCCATTAATCTAACAATCCCCACCAAATATCATGGCT

Reverse complement sequence

AGCCATGATATTTGGTGGGGATTGTTAGATTAATGGACTAGGACCAATTAAATCCTAATAAATTCCATTGGCCCACATTAAGTGCTATGGGTAATAATAC[C/T]
ACCTTGGAAATCTAAGTGAAGAAGTCTCAACTTAAATACAGAGCTAGTGGAGAGTCTTTGTTGACCGGTTGAGATGGTGCGCGGACAACCAGGAGGGCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 32.40% 0.04% 0.00% NA
All Indica  2759 98.10% 1.90% 0.00% 0.00% NA
All Japonica  1512 19.00% 80.90% 0.07% 0.00% NA
Aus  269 52.40% 47.60% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.40% 0.00% 0.00% NA
Temperate Japonica  767 12.80% 87.20% 0.00% 0.00% NA
Tropical Japonica  504 28.60% 71.20% 0.20% 0.00% NA
Japonica Intermediate  241 19.10% 80.90% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810831297 G -> A LOC_Os08g17690.1 upstream_gene_variant ; 4890.0bp to feature; MODIFIER silent_mutation Average:33.88; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0810831297 G -> A LOC_Os08g17700.1 downstream_gene_variant ; 664.0bp to feature; MODIFIER silent_mutation Average:33.88; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0810831297 G -> A LOC_Os08g17690-LOC_Os08g17700 intergenic_region ; MODIFIER silent_mutation Average:33.88; most accessible tissue: Minghui63 root, score: 43.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810831297 NA 1.03E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 4.73E-06 NA mr1949 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 NA 7.47E-17 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 NA 7.59E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 NA 1.49E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 NA 5.03E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 NA 9.21E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 NA 2.30E-07 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 NA 6.14E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 NA 1.30E-06 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 NA 6.44E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 2.82E-06 2.82E-06 mr1592_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 NA 8.98E-06 mr1595_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 NA 8.95E-06 mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810831297 NA 9.18E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251