\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810822568:

Variant ID: vg0810822568 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10822568
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


CGCACACAATACCTCCATCGTATGCCATATGGAATCTCCATCAACCACGTGCATCAACTCTAGCCTTAGTATCCCGCATGATATCTGACCACGTACCACG[G/A]
ACATCGTCTTACTACCAAGCCGACTCCCGGTCCATCACCGCAAATACTCTCCCAAGGCATCGAGTCACCTACACATGAAACAATCAAAGAAACCATATTC

Reverse complement sequence

GAATATGGTTTCTTTGATTGTTTCATGTGTAGGTGACTCGATGCCTTGGGAGAGTATTTGCGGTGATGGACCGGGAGTCGGCTTGGTAGTAAGACGATGT[C/T]
CGTGGTACGTGGTCAGATATCATGCGGGATACTAAGGCTAGAGTTGATGCACGTGGTTGATGGAGATTCCATATGGCATACGATGGAGGTATTGTGTGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 2.70% 0.00% 0.15% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 91.90% 7.70% 0.00% 0.46% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 98.80% 0.30% 0.00% 0.91% NA
Tropical Japonica  504 79.80% 20.20% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810822568 G -> A LOC_Os08g17690.1 downstream_gene_variant ; 1739.0bp to feature; MODIFIER silent_mutation Average:32.36; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0810822568 G -> A LOC_Os08g17680-LOC_Os08g17690 intergenic_region ; MODIFIER silent_mutation Average:32.36; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0810822568 G -> DEL N N silent_mutation Average:32.36; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810822568 NA 7.46E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 1.59E-06 7.77E-09 mr1077_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 9.45E-06 NA mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 2.85E-06 NA mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 7.06E-06 6.85E-07 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 NA 2.18E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 6.75E-06 NA mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 6.14E-06 3.80E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 4.87E-06 4.87E-06 mr1466_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 4.36E-06 4.36E-06 mr1485_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 6.58E-08 6.71E-08 mr1595_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 3.32E-06 8.47E-06 mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 NA 5.07E-06 mr1638_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 NA 4.08E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 NA 6.98E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 NA 9.76E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568 5.24E-06 5.24E-06 mr1985_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251