Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810822568:

Variant ID: vg0810822568 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10822568
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

CGCACACAATACCTCCATCGTATGCCATATGGAATCTCCATCAACCACGTGCATCAACTCTAGCCTTAGTATCCCGCATGATATCTGACCACGTACCACG[G/A]
ACATCGTCTTACTACCAAGCCGACTCCCGGTCCATCACCGCAAATACTCTCCCAAGGCATCGAGTCACCTACACATGAAACAATCAAAGAAACCATATTC

Reverse complement sequence

GAATATGGTTTCTTTGATTGTTTCATGTGTAGGTGACTCGATGCCTTGGGAGAGTATTTGCGGTGATGGACCGGGAGTCGGCTTGGTAGTAAGACGATGT[C/T]
CGTGGTACGTGGTCAGATATCATGCGGGATACTAAGGCTAGAGTTGATGCACGTGGTTGATGGAGATTCCATATGGCATACGATGGAGGTATTGTGTGCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.10%	2.70%	0.00%	0.15%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	91.90%	7.70%	0.00%	0.46%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	98.80%	0.30%	0.00%	0.91%	NA
Tropical Japonica	504	79.80%	20.20%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	5.00%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810822568	G -> A	LOC_Os08g17690.1	downstream_gene_variant ; 1739.0bp to feature; MODIFIER	silent_mutation	Average:32.36; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N
vg0810822568	G -> A	LOC_Os08g17680-LOC_Os08g17690	intergenic_region ; MODIFIER	silent_mutation	Average:32.36; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N
vg0810822568	G -> DEL	N	N	silent_mutation	Average:32.36; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810822568	NA	7.46E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	1.59E-06	7.77E-09	mr1077_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	9.45E-06	NA	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	2.85E-06	NA	mr1085_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	7.06E-06	6.85E-07	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	NA	2.18E-06	mr1200_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	6.75E-06	NA	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	6.14E-06	3.80E-07	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	4.87E-06	4.87E-06	mr1466_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	4.36E-06	4.36E-06	mr1485_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	6.58E-08	6.71E-08	mr1595_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	3.32E-06	8.47E-06	mr1600_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	NA	5.07E-06	mr1638_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	NA	4.08E-06	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	NA	6.98E-06	mr1739_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	NA	9.76E-06	mr1759_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810822568	5.24E-06	5.24E-06	mr1985_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251