\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810748562:

Variant ID: vg0810748562 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10748562
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, A: 0.45, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GCCATTAATCTGGTTTAATTAGAGAAGAAAGAGGAGAAAAGTTCTAATTTTTAAATATTTTTAGAGGGCTTCTAACGGTAACCATTTGGCATAACCTAGG[A/G]
TCAAGGAGGCTCTGATACCAACTTGTCACGCCCGGAATTTCTATCCAAAACTCCAAACTCTTACATGTGTGTAAACCCTCGTCCAGCAATCAGCCGAGGC

Reverse complement sequence

GCCTCGGCTGATTGCTGGACGAGGGTTTACACACATGTAAGAGTTTGGAGTTTTGGATAGAAATTCCGGGCGTGACAAGTTGGTATCAGAGCCTCCTTGA[T/C]
CCTAGGTTATGCCAAATGGTTACCGTTAGAAGCCCTCTAAAAATATTTAAAAATTAGAACTTTTCTCCTCTTTCTTCTCTAATTAAACCAGATTAATGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.70% 15.60% 0.23% 66.48% NA
All Indica  2759 1.80% 14.40% 0.36% 83.47% NA
All Japonica  1512 50.80% 12.50% 0.00% 36.71% NA
Aus  269 0.00% 49.10% 0.00% 50.93% NA
Indica I  595 3.90% 4.40% 0.50% 91.26% NA
Indica II  465 0.90% 9.50% 0.43% 89.25% NA
Indica III  913 0.40% 23.00% 0.22% 76.34% NA
Indica Intermediate  786 2.30% 14.90% 0.38% 82.44% NA
Temperate Japonica  767 85.00% 7.80% 0.00% 7.17% NA
Tropical Japonica  504 8.70% 22.20% 0.00% 69.05% NA
Japonica Intermediate  241 29.90% 7.10% 0.00% 63.07% NA
VI/Aromatic  96 0.00% 6.20% 0.00% 93.75% NA
Intermediate  90 23.30% 12.20% 1.11% 63.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810748562 A -> G LOC_Os08g17560.1 upstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:6.336; most accessible tissue: Callus, score: 17.48 N N N N
vg0810748562 A -> G LOC_Os08g17570.1 intron_variant ; MODIFIER silent_mutation Average:6.336; most accessible tissue: Callus, score: 17.48 N N N N
vg0810748562 A -> DEL N N silent_mutation Average:6.336; most accessible tissue: Callus, score: 17.48 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810748562 NA 2.22E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 NA 6.67E-07 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 NA 1.53E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 NA 2.02E-06 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 3.38E-06 4.85E-06 mr1040_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 NA 2.18E-07 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 7.74E-06 NA mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 4.62E-07 7.11E-06 mr1085_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 9.43E-06 9.44E-06 mr1145_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 5.11E-06 5.41E-06 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 NA 1.98E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 NA 6.54E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 NA 8.72E-06 mr1239_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 NA 9.79E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 4.70E-06 4.70E-06 mr1356_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 5.85E-06 5.85E-06 mr1372_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 NA 6.13E-07 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 4.80E-06 NA mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 7.88E-06 7.88E-06 mr1541_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 8.60E-06 8.60E-06 mr1592_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810748562 NA 5.30E-06 mr1713_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251